FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622893_at:

>probe:Drosophila_2:1622893_at:599:305; Interrogation_Position=137; Antisense; CCTGAATCCTGGCAATGTCATCATC
>probe:Drosophila_2:1622893_at:267:45; Interrogation_Position=142; Antisense; ATCCTGGCAATGTCATCATCAATGG
>probe:Drosophila_2:1622893_at:284:35; Interrogation_Position=15; Antisense; ATCAGTTGTCAACGGCTAATACGCG
>probe:Drosophila_2:1622893_at:525:33; Interrogation_Position=159; Antisense; ATCAATGGCGATTGCCGCGTCTGCA
>probe:Drosophila_2:1622893_at:245:303; Interrogation_Position=173; Antisense; CCGCGTCTGCAATGTGAGGGCCTAA
>probe:Drosophila_2:1622893_at:568:371; Interrogation_Position=212; Antisense; GAAGGATGCCAGTTGAAGTTCACAC
>probe:Drosophila_2:1622893_at:462:373; Interrogation_Position=226; Antisense; GAAGTTCACACAGCCACACATATTT
>probe:Drosophila_2:1622893_at:658:651; Interrogation_Position=23; Antisense; TCAACGGCTAATACGCGGGAGTCAA
>probe:Drosophila_2:1622893_at:230:127; Interrogation_Position=237; Antisense; AGCCACACATATTTTTAAGTCGAAA
>probe:Drosophila_2:1622893_at:372:161; Interrogation_Position=271; Antisense; AAATTCCTAGAATCAAGTGCCCATA
>probe:Drosophila_2:1622893_at:568:671; Interrogation_Position=34; Antisense; TACGCGGGAGTCAAGCTCAGAATTC
>probe:Drosophila_2:1622893_at:309:495; Interrogation_Position=43; Antisense; GTCAAGCTCAGAATTCAACCACAAA
>probe:Drosophila_2:1622893_at:31:151; Interrogation_Position=76; Antisense; ACATGAAATTCCTATCACTCGCCTT
>probe:Drosophila_2:1622893_at:582:685; Interrogation_Position=88; Antisense; TATCACTCGCCTTCGTTTTGGGTCT

Paste this into a BLAST search page for me
CCTGAATCCTGGCAATGTCATCATCATCCTGGCAATGTCATCATCAATGGATCAGTTGTCAACGGCTAATACGCGATCAATGGCGATTGCCGCGTCTGCACCGCGTCTGCAATGTGAGGGCCTAAGAAGGATGCCAGTTGAAGTTCACACGAAGTTCACACAGCCACACATATTTTCAACGGCTAATACGCGGGAGTCAAAGCCACACATATTTTTAAGTCGAAAAAATTCCTAGAATCAAGTGCCCATATACGCGGGAGTCAAGCTCAGAATTCGTCAAGCTCAGAATTCAACCACAAAACATGAAATTCCTATCACTCGCCTTTATCACTCGCCTTCGTTTTGGGTCT

Full Affymetrix probeset data:

Annotations for 1622893_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720