FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622894_at:

>probe:Drosophila_2:1622894_at:592:173; Interrogation_Position=516; Antisense; AAAGCTGGACTACAGCCTCTATCTG
>probe:Drosophila_2:1622894_at:390:643; Interrogation_Position=545; Antisense; TCTTCTTCGACGGACTGGCGGAGAC
>probe:Drosophila_2:1622894_at:23:391; Interrogation_Position=570; Antisense; GAAACATCCCTACAAGACCTATGCC
>probe:Drosophila_2:1622894_at:644:445; Interrogation_Position=636; Antisense; GATACACCCGGTGATACCGCAATTA
>probe:Drosophila_2:1622894_at:73:383; Interrogation_Position=675; Antisense; GAACGCATTGAGCACACGAAACCTG
>probe:Drosophila_2:1622894_at:529:175; Interrogation_Position=693; Antisense; AAACCTGGAGGTAATGTGCACGACA
>probe:Drosophila_2:1622894_at:556:187; Interrogation_Position=731; Antisense; AACAGCTGGTCATGTCCTCGGATTT
>probe:Drosophila_2:1622894_at:602:93; Interrogation_Position=788; Antisense; AGTTGCTGCCCATGTTCAATGCATT
>probe:Drosophila_2:1622894_at:336:613; Interrogation_Position=818; Antisense; TGAAAAACTTAAACTGCGGCGATGA
>probe:Drosophila_2:1622894_at:458:327; Interrogation_Position=836; Antisense; GCGATGAGATCGACTATGCCCAGAA
>probe:Drosophila_2:1622894_at:361:57; Interrogation_Position=890; Antisense; ATGAGACGCTGCAGGTGCTGGAACT
>probe:Drosophila_2:1622894_at:459:413; Interrogation_Position=960; Antisense; GACCTACGAGTCCTGCTATTTAAAT
>probe:Drosophila_2:1622894_at:303:707; Interrogation_Position=984; Antisense; TTAAACTACGCCTCATGGTCTTGTC
>probe:Drosophila_2:1622894_at:10:65; Interrogation_Position=998; Antisense; ATGGTCTTGTCCCTTTACATACAAT

Paste this into a BLAST search page for me
AAAGCTGGACTACAGCCTCTATCTGTCTTCTTCGACGGACTGGCGGAGACGAAACATCCCTACAAGACCTATGCCGATACACCCGGTGATACCGCAATTAGAACGCATTGAGCACACGAAACCTGAAACCTGGAGGTAATGTGCACGACAAACAGCTGGTCATGTCCTCGGATTTAGTTGCTGCCCATGTTCAATGCATTTGAAAAACTTAAACTGCGGCGATGAGCGATGAGATCGACTATGCCCAGAAATGAGACGCTGCAGGTGCTGGAACTGACCTACGAGTCCTGCTATTTAAATTTAAACTACGCCTCATGGTCTTGTCATGGTCTTGTCCCTTTACATACAAT

Full Affymetrix probeset data:

Annotations for 1622894_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720