FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622895_at:

>probe:Drosophila_2:1622895_at:613:389; Interrogation_Position=1373; Antisense; GAAACATTTGGGATGCTGTTCCGTA
>probe:Drosophila_2:1622895_at:725:333; Interrogation_Position=1387; Antisense; GCTGTTCCGTATGAAGCGCATGTAC
>probe:Drosophila_2:1622895_at:245:323; Interrogation_Position=1402; Antisense; GCGCATGTACAAAGCCGAACTGGAT
>probe:Drosophila_2:1622895_at:514:49; Interrogation_Position=1490; Antisense; ATGCGCAGTCTGTTAGTACACTCAA
>probe:Drosophila_2:1622895_at:286:679; Interrogation_Position=1503; Antisense; TAGTACACTCAAATGCCGATCTCTC
>probe:Drosophila_2:1622895_at:204:453; Interrogation_Position=1520; Antisense; GATCTCTCGGTTACCCTTATTTTTG
>probe:Drosophila_2:1622895_at:86:87; Interrogation_Position=1560; Antisense; AGTCCAGGTCTTTGATTTTTGATCG
>probe:Drosophila_2:1622895_at:436:619; Interrogation_Position=1609; Antisense; TGCATTTAGCAATTACTCAGCGCCC
>probe:Drosophila_2:1622895_at:112:707; Interrogation_Position=1621; Antisense; TTACTCAGCGCCCATTCTAAAAGGA
>probe:Drosophila_2:1622895_at:151:185; Interrogation_Position=1639; Antisense; AAAAGGATTATTACCGCTCGCAGAT
>probe:Drosophila_2:1622895_at:513:177; Interrogation_Position=1700; Antisense; AAACTCTGCGATGCACAGCTTGAAG
>probe:Drosophila_2:1622895_at:2:397; Interrogation_Position=1859; Antisense; GACAAGCATACCGATTGGCCCAAAT
>probe:Drosophila_2:1622895_at:340:257; Interrogation_Position=1879; Antisense; CAAATGTGCATTGGGTGTGCTCCCT
>probe:Drosophila_2:1622895_at:577:515; Interrogation_Position=1893; Antisense; GTGTGCTCCCTTGGGCTCAATAAAT

Paste this into a BLAST search page for me
GAAACATTTGGGATGCTGTTCCGTAGCTGTTCCGTATGAAGCGCATGTACGCGCATGTACAAAGCCGAACTGGATATGCGCAGTCTGTTAGTACACTCAATAGTACACTCAAATGCCGATCTCTCGATCTCTCGGTTACCCTTATTTTTGAGTCCAGGTCTTTGATTTTTGATCGTGCATTTAGCAATTACTCAGCGCCCTTACTCAGCGCCCATTCTAAAAGGAAAAAGGATTATTACCGCTCGCAGATAAACTCTGCGATGCACAGCTTGAAGGACAAGCATACCGATTGGCCCAAATCAAATGTGCATTGGGTGTGCTCCCTGTGTGCTCCCTTGGGCTCAATAAAT

Full Affymetrix probeset data:

Annotations for 1622895_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720