Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622896_at:

>probe:Drosophila_2:1622896_at:241:277; Interrogation_Position=1007; Antisense; CTAATTCCCCACTTAACCATATTTG
>probe:Drosophila_2:1622896_at:315:207; Interrogation_Position=561; Antisense; AAGCTCATCAAGAGATCCGTGGAAA
>probe:Drosophila_2:1622896_at:467:173; Interrogation_Position=583; Antisense; AAAGCTGGACCGCATATCCATGTCA
>probe:Drosophila_2:1622896_at:75:25; Interrogation_Position=596; Antisense; ATATCCATGTCAGCCCAAGCTATTG
>probe:Drosophila_2:1622896_at:373:117; Interrogation_Position=613; Antisense; AGCTATTGGAATTCACCAACGCCCC
>probe:Drosophila_2:1622896_at:622:301; Interrogation_Position=636; Antisense; CCGCGCCATGTGAACTTCTTTTTGA
>probe:Drosophila_2:1622896_at:258:707; Interrogation_Position=667; Antisense; TTAGAATATTCATGACGCCCAAGAT
>probe:Drosophila_2:1622896_at:163:33; Interrogation_Position=690; Antisense; ATAAGATCGCGACTTTTCGTGCGTC
>probe:Drosophila_2:1622896_at:7:641; Interrogation_Position=704; Antisense; TTTCGTGCGTCGTGAAGGAACATCC
>probe:Drosophila_2:1622896_at:471:73; Interrogation_Position=719; Antisense; AGGAACATCCGTGAGCTGCGATCAG
>probe:Drosophila_2:1622896_at:285:119; Interrogation_Position=732; Antisense; AGCTGCGATCAGTTGCCAAAGGAAC
>probe:Drosophila_2:1622896_at:517:191; Interrogation_Position=754; Antisense; AACTCGGTGGTCAGGGATTAAGCTA
>probe:Drosophila_2:1622896_at:366:381; Interrogation_Position=818; Antisense; GAACGCCGATTTCTATGTGGAACAA
>probe:Drosophila_2:1622896_at:274:257; Interrogation_Position=955; Antisense; CAAAGGCGCATATCAGTTGTCATAT

Paste this into a BLAST search page for me
CTAATTCCCCACTTAACCATATTTGAAGCTCATCAAGAGATCCGTGGAAAAAAGCTGGACCGCATATCCATGTCAATATCCATGTCAGCCCAAGCTATTGAGCTATTGGAATTCACCAACGCCCCCCGCGCCATGTGAACTTCTTTTTGATTAGAATATTCATGACGCCCAAGATATAAGATCGCGACTTTTCGTGCGTCTTTCGTGCGTCGTGAAGGAACATCCAGGAACATCCGTGAGCTGCGATCAGAGCTGCGATCAGTTGCCAAAGGAACAACTCGGTGGTCAGGGATTAAGCTAGAACGCCGATTTCTATGTGGAACAACAAAGGCGCATATCAGTTGTCATAT

Full Affymetrix probeset data:

Annotations for 1622896_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime