FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622897_at:

>probe:Drosophila_2:1622897_at:125:47; Interrogation_Position=2531; Antisense; ATCCCGCTGGTCCTCATATGCATCA
>probe:Drosophila_2:1622897_at:348:279; Interrogation_Position=2543; Antisense; CTCATATGCATCATCCGCACATGAT
>probe:Drosophila_2:1622897_at:80:357; Interrogation_Position=2559; Antisense; GCACATGATGGGATCCAGCGCAACG
>probe:Drosophila_2:1622897_at:429:119; Interrogation_Position=2575; Antisense; AGCGCAACGGGATCGTCGTACTCCG
>probe:Drosophila_2:1622897_at:72:313; Interrogation_Position=2635; Antisense; GCCACCTGCTATACCGGACTGGGTG
>probe:Drosophila_2:1622897_at:675:597; Interrogation_Position=2729; Antisense; TGTCGCTCTCGCCAGTGGGATCCGA
>probe:Drosophila_2:1622897_at:549:593; Interrogation_Position=2744; Antisense; TGGGATCCGATCACGCCAAGGTGTT
>probe:Drosophila_2:1622897_at:284:251; Interrogation_Position=2760; Antisense; CAAGGTGTTCGACCGCAGTCCAGTG
>probe:Drosophila_2:1622897_at:531:85; Interrogation_Position=2776; Antisense; AGTCCAGTGGCTCAATCCGCTCCAT
>probe:Drosophila_2:1622897_at:699:397; Interrogation_Position=2907; Antisense; GACAACTGTGATTGCGGAGCCCAAG
>probe:Drosophila_2:1622897_at:57:379; Interrogation_Position=2934; Antisense; GAAGCTCTTCAAGCCCTACAAGACT
>probe:Drosophila_2:1622897_at:670:211; Interrogation_Position=2953; Antisense; AAGACTGAGGCGTAAGCCCGCGATC
>probe:Drosophila_2:1622897_at:238:191; Interrogation_Position=3026; Antisense; AACTAGTCTTAGTCAGCCTCATCTA
>probe:Drosophila_2:1622897_at:510:699; Interrogation_Position=3052; Antisense; TTATTCCCGAAGATTGTACAGATTG

Paste this into a BLAST search page for me
ATCCCGCTGGTCCTCATATGCATCACTCATATGCATCATCCGCACATGATGCACATGATGGGATCCAGCGCAACGAGCGCAACGGGATCGTCGTACTCCGGCCACCTGCTATACCGGACTGGGTGTGTCGCTCTCGCCAGTGGGATCCGATGGGATCCGATCACGCCAAGGTGTTCAAGGTGTTCGACCGCAGTCCAGTGAGTCCAGTGGCTCAATCCGCTCCATGACAACTGTGATTGCGGAGCCCAAGGAAGCTCTTCAAGCCCTACAAGACTAAGACTGAGGCGTAAGCCCGCGATCAACTAGTCTTAGTCAGCCTCATCTATTATTCCCGAAGATTGTACAGATTG

Full Affymetrix probeset data:

Annotations for 1622897_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720