Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622898_a_at:

>probe:Drosophila_2:1622898_a_at:23:661; Interrogation_Position=136; Antisense; TAAACACCAGTTCCGGCGTACAAGG
>probe:Drosophila_2:1622898_a_at:94:491; Interrogation_Position=153; Antisense; GTACAAGGCAATCTTTCACCTGCGG
>probe:Drosophila_2:1622898_a_at:707:561; Interrogation_Position=188; Antisense; GGAACCGGATAAACTCTACAGCAAG
>probe:Drosophila_2:1622898_a_at:297:93; Interrogation_Position=245; Antisense; AGTTCTGAAGAGCTACACCTGGTTT
>probe:Drosophila_2:1622898_a_at:625:665; Interrogation_Position=258; Antisense; TACACCTGGTTTGCTACTACTGCTG
>probe:Drosophila_2:1622898_a_at:536:669; Interrogation_Position=275; Antisense; TACTGCTGCCGAGCATTTGGGCATT
>probe:Drosophila_2:1622898_a_at:183:185; Interrogation_Position=308; Antisense; AAAATGTTGGTCACCTCGCAAGGCG
>probe:Drosophila_2:1622898_a_at:69:57; Interrogation_Position=345; Antisense; ATGACGCTCCTGAAGTCGGTGCATA
>probe:Drosophila_2:1622898_a_at:478:663; Interrogation_Position=388; Antisense; TACAGTACGAGGTGCGAACCCACTT
>probe:Drosophila_2:1622898_a_at:225:217; Interrogation_Position=432; Antisense; AAGTTGACGGGCTCCACGCTAGATA
>probe:Drosophila_2:1622898_a_at:269:685; Interrogation_Position=470; Antisense; TATTGAACGTAATCTGCCCGAGGGC
>probe:Drosophila_2:1622898_a_at:317:675; Interrogation_Position=496; Antisense; TAGCGCTGCAGGCTTCCAGGACTGA
>probe:Drosophila_2:1622898_a_at:111:119; Interrogation_Position=520; Antisense; AGCTGCAGGAGATCCCAGAGCACTT
>probe:Drosophila_2:1622898_a_at:652:301; Interrogation_Position=664; Antisense; CCCCGTCCGCGATTAGCAAAGATAA

Paste this into a BLAST search page for me
TAAACACCAGTTCCGGCGTACAAGGGTACAAGGCAATCTTTCACCTGCGGGGAACCGGATAAACTCTACAGCAAGAGTTCTGAAGAGCTACACCTGGTTTTACACCTGGTTTGCTACTACTGCTGTACTGCTGCCGAGCATTTGGGCATTAAAATGTTGGTCACCTCGCAAGGCGATGACGCTCCTGAAGTCGGTGCATATACAGTACGAGGTGCGAACCCACTTAAGTTGACGGGCTCCACGCTAGATATATTGAACGTAATCTGCCCGAGGGCTAGCGCTGCAGGCTTCCAGGACTGAAGCTGCAGGAGATCCCAGAGCACTTCCCCGTCCGCGATTAGCAAAGATAA

Full Affymetrix probeset data:

Annotations for 1622898_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime