FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622900_at:

>probe:Drosophila_2:1622900_at:149:615; Interrogation_Position=1064; Antisense; TGAAGCTCCATATGTACGGCCTTTT
>probe:Drosophila_2:1622900_at:151:439; Interrogation_Position=1100; Antisense; GAGGAACATCCTTTGCCGTGTTTAA
>probe:Drosophila_2:1622900_at:435:545; Interrogation_Position=600; Antisense; GGATCTTCAGGCGATTGTGACCGAA
>probe:Drosophila_2:1622900_at:334:511; Interrogation_Position=661; Antisense; GTGACCAAGTGTTGCTACCTAGCGG
>probe:Drosophila_2:1622900_at:300:121; Interrogation_Position=695; Antisense; AGCGAATAGCCAAGTCCCAGTCGGA
>probe:Drosophila_2:1622900_at:322:499; Interrogation_Position=714; Antisense; GTCGGACCTACAGGAGCTCGTCGAA
>probe:Drosophila_2:1622900_at:58:503; Interrogation_Position=733; Antisense; GTCGAAAACTTGTCCACGGCATACG
>probe:Drosophila_2:1622900_at:159:551; Interrogation_Position=760; Antisense; GGAGAAGTGGTCTGCCTGGTCATCA
>probe:Drosophila_2:1622900_at:365:669; Interrogation_Position=787; Antisense; TACTATCTGAATATGCTGGGCACCT
>probe:Drosophila_2:1622900_at:465:525; Interrogation_Position=850; Antisense; GGGAATAACCTGCTCGTGATCATCA
>probe:Drosophila_2:1622900_at:600:291; Interrogation_Position=864; Antisense; CGTGATCATCACTCTTTGTGGCATT
>probe:Drosophila_2:1622900_at:491:723; Interrogation_Position=879; Antisense; TTGTGGCATTGTCTACTTCGTATTT
>probe:Drosophila_2:1622900_at:600:707; Interrogation_Position=903; Antisense; TTACGTCGTCGATTGCTGGATCAAC
>probe:Drosophila_2:1622900_at:203:123; Interrogation_Position=986; Antisense; AGCGAACTTTGTTTCAGCCAGGTCT

Paste this into a BLAST search page for me
TGAAGCTCCATATGTACGGCCTTTTGAGGAACATCCTTTGCCGTGTTTAAGGATCTTCAGGCGATTGTGACCGAAGTGACCAAGTGTTGCTACCTAGCGGAGCGAATAGCCAAGTCCCAGTCGGAGTCGGACCTACAGGAGCTCGTCGAAGTCGAAAACTTGTCCACGGCATACGGGAGAAGTGGTCTGCCTGGTCATCATACTATCTGAATATGCTGGGCACCTGGGAATAACCTGCTCGTGATCATCACGTGATCATCACTCTTTGTGGCATTTTGTGGCATTGTCTACTTCGTATTTTTACGTCGTCGATTGCTGGATCAACAGCGAACTTTGTTTCAGCCAGGTCT

Full Affymetrix probeset data:

Annotations for 1622900_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720