Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622901_at:

>probe:Drosophila_2:1622901_at:590:571; Interrogation_Position=1262; Antisense; GGCTACTATCACAATCCGCAGGAGA
>probe:Drosophila_2:1622901_at:195:349; Interrogation_Position=1279; Antisense; GCAGGAGACCCAGGTGACCGTCACG
>probe:Drosophila_2:1622901_at:292:141; Interrogation_Position=1308; Antisense; ACGGCAAGTGGTTGCTCACCGGCGA
>probe:Drosophila_2:1622901_at:10:651; Interrogation_Position=1323; Antisense; TCACCGGCGATCATGGATACTTTGA
>probe:Drosophila_2:1622901_at:295:669; Interrogation_Position=1340; Antisense; TACTTTGACGATGAGGGCTGCCTGC
>probe:Drosophila_2:1622901_at:264:651; Interrogation_Position=1392; Antisense; TCAAGTACAATCACTTCCCCATTTA
>probe:Drosophila_2:1622901_at:443:451; Interrogation_Position=1426; Antisense; GATCGAGGACGTGATTCTCCATCTG
>probe:Drosophila_2:1622901_at:599:21; Interrogation_Position=1446; Antisense; ATCTGCCCGGAGTCCACGAAGTGGC
>probe:Drosophila_2:1622901_at:272:221; Interrogation_Position=1464; Antisense; AAGTGGCTGTCTTCGGAATTCCCGA
>probe:Drosophila_2:1622901_at:477:607; Interrogation_Position=1489; Antisense; TGAGGTGTCCACCAATCTTACAGCC
>probe:Drosophila_2:1622901_at:367:667; Interrogation_Position=1507; Antisense; TACAGCCTGTGCAGTGGTTCGGAAT
>probe:Drosophila_2:1622901_at:429:467; Interrogation_Position=1577; Antisense; GTTGTGGCACAACATCTAAGCGATG
>probe:Drosophila_2:1622901_at:683:45; Interrogation_Position=1610; Antisense; ATCCGCGGAGGAGTCTTCTTTGTGG
>probe:Drosophila_2:1622901_at:404:657; Interrogation_Position=1628; Antisense; TTTGTGGACAATCTGCCGAAGACGC

Paste this into a BLAST search page for me
GGCTACTATCACAATCCGCAGGAGAGCAGGAGACCCAGGTGACCGTCACGACGGCAAGTGGTTGCTCACCGGCGATCACCGGCGATCATGGATACTTTGATACTTTGACGATGAGGGCTGCCTGCTCAAGTACAATCACTTCCCCATTTAGATCGAGGACGTGATTCTCCATCTGATCTGCCCGGAGTCCACGAAGTGGCAAGTGGCTGTCTTCGGAATTCCCGATGAGGTGTCCACCAATCTTACAGCCTACAGCCTGTGCAGTGGTTCGGAATGTTGTGGCACAACATCTAAGCGATGATCCGCGGAGGAGTCTTCTTTGTGGTTTGTGGACAATCTGCCGAAGACGC

Full Affymetrix probeset data:

Annotations for 1622901_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime