FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622902_at:

>probe:Drosophila_2:1622902_at:722:261; Interrogation_Position=144; Antisense; CAGCCGAGAGCTGCATGCCGGAAGT
>probe:Drosophila_2:1622902_at:283:313; Interrogation_Position=173; Antisense; GCCACCGATGCCGATCTGCAGGAAA
>probe:Drosophila_2:1622902_at:284:211; Interrogation_Position=203; Antisense; AAGAAGCAGCCAGCCAGCACATATG
>probe:Drosophila_2:1622902_at:712:397; Interrogation_Position=25; Antisense; GACACACCGACCTAGCATCATGCAG
>probe:Drosophila_2:1622902_at:161:385; Interrogation_Position=259; Antisense; GAACATCGGAATTCTGGACGCCAAC
>probe:Drosophila_2:1622902_at:522:195; Interrogation_Position=288; Antisense; AACTGGACACGGAGGCAGGTCACGA
>probe:Drosophila_2:1622902_at:10:91; Interrogation_Position=324; Antisense; AGTACACGGGCAACGATCCGGCCAA
>probe:Drosophila_2:1622902_at:45:217; Interrogation_Position=353; Antisense; AAGATTGCCCTGGAGATCGGCGACA
>probe:Drosophila_2:1622902_at:579:259; Interrogation_Position=391; Antisense; CACTGTGCCGGATGATCACTGCGAG
>probe:Drosophila_2:1622902_at:689:377; Interrogation_Position=422; Antisense; GAAGCCTATGGCACTTGCTTCAGGG
>probe:Drosophila_2:1622902_at:693:53; Interrogation_Position=44; Antisense; ATGCAGTCTACTCCAATCATTCTGG
>probe:Drosophila_2:1622902_at:489:491; Interrogation_Position=472; Antisense; GTAATCATTGATGCAGCGCTACCCA
>probe:Drosophila_2:1622902_at:12:239; Interrogation_Position=58; Antisense; AATCATTCTGGTGGCAATCGTCCTT
>probe:Drosophila_2:1622902_at:389:355; Interrogation_Position=92; Antisense; GCACTGGTGCGAGCCTTTGACGAGA

Paste this into a BLAST search page for me
CAGCCGAGAGCTGCATGCCGGAAGTGCCACCGATGCCGATCTGCAGGAAAAAGAAGCAGCCAGCCAGCACATATGGACACACCGACCTAGCATCATGCAGGAACATCGGAATTCTGGACGCCAACAACTGGACACGGAGGCAGGTCACGAAGTACACGGGCAACGATCCGGCCAAAAGATTGCCCTGGAGATCGGCGACACACTGTGCCGGATGATCACTGCGAGGAAGCCTATGGCACTTGCTTCAGGGATGCAGTCTACTCCAATCATTCTGGGTAATCATTGATGCAGCGCTACCCAAATCATTCTGGTGGCAATCGTCCTTGCACTGGTGCGAGCCTTTGACGAGA

Full Affymetrix probeset data:

Annotations for 1622902_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720