FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622906_at:

>probe:Drosophila_2:1622906_at:542:729; Interrogation_Position=113; Antisense; TTGGAATAACAACTGCCGCTGGAAT
>probe:Drosophila_2:1622906_at:88:561; Interrogation_Position=139; Antisense; GGAACTTTACTGATCCAACCAGGGT
>probe:Drosophila_2:1622906_at:162:151; Interrogation_Position=179; Antisense; ACATTGTATGTTTTCCAGTGGCCCA
>probe:Drosophila_2:1622906_at:727:133; Interrogation_Position=233; Antisense; ACGCCATCAGCCACTGTACTATGTG
>probe:Drosophila_2:1622906_at:443:215; Interrogation_Position=274; Antisense; AAGATCATGTTGTCTATCCACTCCA
>probe:Drosophila_2:1622906_at:485:683; Interrogation_Position=357; Antisense; TATCCGTTGTCGCACCAATTGTATC
>probe:Drosophila_2:1622906_at:307:513; Interrogation_Position=383; Antisense; GTGAGATCGCGAGACTACACCGTTC
>probe:Drosophila_2:1622906_at:677:257; Interrogation_Position=416; Antisense; CACCTTCTAATTGCAGCTCGGATGT
>probe:Drosophila_2:1622906_at:27:299; Interrogation_Position=529; Antisense; CGCAGCCTTGACTAATCCGAAACAT
>probe:Drosophila_2:1622906_at:428:189; Interrogation_Position=549; Antisense; AACATGCACCCGGATCGGATCGAAT
>probe:Drosophila_2:1622906_at:704:289; Interrogation_Position=564; Antisense; CGGATCGAATGCACGCATGTGGCAT
>probe:Drosophila_2:1622906_at:142:605; Interrogation_Position=594; Antisense; TGTTGGCCATCGTAGTGATCTGCAT
>probe:Drosophila_2:1622906_at:160:605; Interrogation_Position=609; Antisense; TGATCTGCATACCTACTTACACACT
>probe:Drosophila_2:1622906_at:68:661; Interrogation_Position=633; Antisense; TAACCACACAACCATGAGTCGCACA

Paste this into a BLAST search page for me
TTGGAATAACAACTGCCGCTGGAATGGAACTTTACTGATCCAACCAGGGTACATTGTATGTTTTCCAGTGGCCCAACGCCATCAGCCACTGTACTATGTGAAGATCATGTTGTCTATCCACTCCATATCCGTTGTCGCACCAATTGTATCGTGAGATCGCGAGACTACACCGTTCCACCTTCTAATTGCAGCTCGGATGTCGCAGCCTTGACTAATCCGAAACATAACATGCACCCGGATCGGATCGAATCGGATCGAATGCACGCATGTGGCATTGTTGGCCATCGTAGTGATCTGCATTGATCTGCATACCTACTTACACACTTAACCACACAACCATGAGTCGCACA

Full Affymetrix probeset data:

Annotations for 1622906_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720