FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622907_at:

>probe:Drosophila_2:1622907_at:134:149; Interrogation_Position=124; Antisense; ACACCGGCGGAGTGGAGAACACCCT
>probe:Drosophila_2:1622907_at:468:75; Interrogation_Position=160; Antisense; AGGAGGGAGCTCTATTGGCCTACTC
>probe:Drosophila_2:1622907_at:58:315; Interrogation_Position=177; Antisense; GCCTACTCCGGTTATGGCGATAAGG
>probe:Drosophila_2:1622907_at:601:21; Interrogation_Position=234; Antisense; ATATGGGCGGCCTACGAGAAGCATG
>probe:Drosophila_2:1622907_at:79:377; Interrogation_Position=251; Antisense; GAAGCATGGACGCAACGCCTTTCGC
>probe:Drosophila_2:1622907_at:84:259; Interrogation_Position=287; Antisense; CACTTTCGTGCTCATCGATTGTGAA
>probe:Drosophila_2:1622907_at:643:537; Interrogation_Position=315; Antisense; GGTCATGTGGCCATCACACAGGTTG
>probe:Drosophila_2:1622907_at:92:155; Interrogation_Position=332; Antisense; ACAGGTTGCCAGTGTCCTTTTGTGC
>probe:Drosophila_2:1622907_at:202:703; Interrogation_Position=349; Antisense; TTTTGTGCCTGTACGCCAAGCAAAC
>probe:Drosophila_2:1622907_at:597:255; Interrogation_Position=369; Antisense; CAAACGGTGGGATTGGGTCTTCTGA
>probe:Drosophila_2:1622907_at:321:495; Interrogation_Position=407; Antisense; GTCACTGGCCTCCTATTTGGAGCGA
>probe:Drosophila_2:1622907_at:29:709; Interrogation_Position=436; Antisense; TTAAGCAGATCTCGGCCTCATAAGG
>probe:Drosophila_2:1622907_at:384:377; Interrogation_Position=618; Antisense; GAAAAACTTGTCTGCTGGTTTCCAA
>probe:Drosophila_2:1622907_at:524:173; Interrogation_Position=93; Antisense; AAAGCTTTGACGCAGGTTCTCAGCC

Paste this into a BLAST search page for me
ACACCGGCGGAGTGGAGAACACCCTAGGAGGGAGCTCTATTGGCCTACTCGCCTACTCCGGTTATGGCGATAAGGATATGGGCGGCCTACGAGAAGCATGGAAGCATGGACGCAACGCCTTTCGCCACTTTCGTGCTCATCGATTGTGAAGGTCATGTGGCCATCACACAGGTTGACAGGTTGCCAGTGTCCTTTTGTGCTTTTGTGCCTGTACGCCAAGCAAACCAAACGGTGGGATTGGGTCTTCTGAGTCACTGGCCTCCTATTTGGAGCGATTAAGCAGATCTCGGCCTCATAAGGGAAAAACTTGTCTGCTGGTTTCCAAAAAGCTTTGACGCAGGTTCTCAGCC

Full Affymetrix probeset data:

Annotations for 1622907_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720