FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622909_at:

>probe:Drosophila_2:1622909_at:489:493; Interrogation_Position=2791; Antisense; GTAATACTGCATTTCGCGTGATAAT
>probe:Drosophila_2:1622909_at:135:33; Interrogation_Position=2818; Antisense; ATAAGTCGAGCTATCTGTTGTTGCA
>probe:Drosophila_2:1622909_at:447:39; Interrogation_Position=2830; Antisense; ATCTGTTGTTGCATCAACGCCCTAT
>probe:Drosophila_2:1622909_at:401:321; Interrogation_Position=2848; Antisense; GCCCTATCCCGTATCCATTATAAAT
>probe:Drosophila_2:1622909_at:555:163; Interrogation_Position=2869; Antisense; AAATATTGTTATTACGCTGCGCGTT
>probe:Drosophila_2:1622909_at:389:163; Interrogation_Position=2923; Antisense; AAATTTTCTGCATTTCTTCAGCACA
>probe:Drosophila_2:1622909_at:123:711; Interrogation_Position=2939; Antisense; TTCAGCACATTTCGTCGTGTTCATG
>probe:Drosophila_2:1622909_at:485:377; Interrogation_Position=2988; Antisense; GAAGCACACGCTTGCAAAACGTTTG
>probe:Drosophila_2:1622909_at:381:539; Interrogation_Position=3027; Antisense; GGTTTTGATAACCTAGCCGCAACAG
>probe:Drosophila_2:1622909_at:303:261; Interrogation_Position=3063; Antisense; CACCCCTTGCTCTAATATTTGTTGT
>probe:Drosophila_2:1622909_at:143:39; Interrogation_Position=3123; Antisense; ATCTACGTACGTTTACTCGATGTGA
>probe:Drosophila_2:1622909_at:78:603; Interrogation_Position=3157; Antisense; TGTTGCTAACGTTAATTTTCCTTCA
>probe:Drosophila_2:1622909_at:552:157; Interrogation_Position=3245; Antisense; ACAACACATATACACTCAGTCGGAA
>probe:Drosophila_2:1622909_at:721:99; Interrogation_Position=3308; Antisense; AGAGAACTTTACACGCAGATGCAAA

Paste this into a BLAST search page for me
GTAATACTGCATTTCGCGTGATAATATAAGTCGAGCTATCTGTTGTTGCAATCTGTTGTTGCATCAACGCCCTATGCCCTATCCCGTATCCATTATAAATAAATATTGTTATTACGCTGCGCGTTAAATTTTCTGCATTTCTTCAGCACATTCAGCACATTTCGTCGTGTTCATGGAAGCACACGCTTGCAAAACGTTTGGGTTTTGATAACCTAGCCGCAACAGCACCCCTTGCTCTAATATTTGTTGTATCTACGTACGTTTACTCGATGTGATGTTGCTAACGTTAATTTTCCTTCAACAACACATATACACTCAGTCGGAAAGAGAACTTTACACGCAGATGCAAA

Full Affymetrix probeset data:

Annotations for 1622909_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720