Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622912_at:

>probe:Drosophila_2:1622912_at:231:309; Interrogation_Position=1050; Antisense; CCAGATCGTGCAGCGTGGCGGAATT
>probe:Drosophila_2:1622912_at:611:567; Interrogation_Position=1090; Antisense; GGCAGCATCCCGAATGTGCAGCGAG
>probe:Drosophila_2:1622912_at:125:327; Interrogation_Position=1117; Antisense; GCGTTGGTCAATCTGGGCGACCTAA
>probe:Drosophila_2:1622912_at:377:209; Interrogation_Position=1159; Antisense; AAGCACCTGATCATGAATCGCCTGC
>probe:Drosophila_2:1622912_at:191:407; Interrogation_Position=1192; Antisense; GACTGTCACACAGTGCACGTGCTGG
>probe:Drosophila_2:1622912_at:207:597; Interrogation_Position=1225; Antisense; TGTGCCGGATTCGTGGCAGCGATCA
>probe:Drosophila_2:1622912_at:536:211; Interrogation_Position=1273; Antisense; AAGACGCGCATCATGAACCAGCCCA
>probe:Drosophila_2:1622912_at:383:143; Interrogation_Position=1340; Antisense; ACTGCCTGCGACAGACGGTTTCGAA
>probe:Drosophila_2:1622912_at:420:521; Interrogation_Position=1375; Antisense; GTGGCGCTGTACAAAGGCTTTCTGC
>probe:Drosophila_2:1622912_at:206:643; Interrogation_Position=1395; Antisense; TCTGCCCTGCTGGATACGAATGGCG
>probe:Drosophila_2:1622912_at:126:599; Interrogation_Position=1442; Antisense; TGTCCTTCGAACAGATCCGCAAGAT
>probe:Drosophila_2:1622912_at:342:303; Interrogation_Position=956; Antisense; CCGCTGACCTCGTCAAGGTGCAAAT
>probe:Drosophila_2:1622912_at:229:227; Interrogation_Position=978; Antisense; AATCCAAATGGAGGGCCGACGACGT
>probe:Drosophila_2:1622912_at:722:295; Interrogation_Position=994; Antisense; CGACGACGTCTGATGGGCGAGCCAC

Paste this into a BLAST search page for me
CCAGATCGTGCAGCGTGGCGGAATTGGCAGCATCCCGAATGTGCAGCGAGGCGTTGGTCAATCTGGGCGACCTAAAAGCACCTGATCATGAATCGCCTGCGACTGTCACACAGTGCACGTGCTGGTGTGCCGGATTCGTGGCAGCGATCAAAGACGCGCATCATGAACCAGCCCAACTGCCTGCGACAGACGGTTTCGAAGTGGCGCTGTACAAAGGCTTTCTGCTCTGCCCTGCTGGATACGAATGGCGTGTCCTTCGAACAGATCCGCAAGATCCGCTGACCTCGTCAAGGTGCAAATAATCCAAATGGAGGGCCGACGACGTCGACGACGTCTGATGGGCGAGCCAC

Full Affymetrix probeset data:

Annotations for 1622912_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime