FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622915_at:

>probe:Drosophila_2:1622915_at:481:243; Interrogation_Position=1036; Antisense; AATATTCAAGGACGATCCAGCCCCA
>probe:Drosophila_2:1622915_at:53:23; Interrogation_Position=1086; Antisense; ATATATTCATTTTGTGTCCCTCGTC
>probe:Drosophila_2:1622915_at:187:281; Interrogation_Position=1105; Antisense; CTCGTCCCGCGCATAAATTTTATTG
>probe:Drosophila_2:1622915_at:566:385; Interrogation_Position=652; Antisense; GAACATCTCTGAACTTTAGGGCTAT
>probe:Drosophila_2:1622915_at:9:681; Interrogation_Position=668; Antisense; TAGGGCTATTTTCCAACATTGCATG
>probe:Drosophila_2:1622915_at:198:729; Interrogation_Position=729; Antisense; TTGGGTGCGGTTTTCAATTCACATT
>probe:Drosophila_2:1622915_at:32:247; Interrogation_Position=744; Antisense; AATTCACATTGTACCGGGCATGAGT
>probe:Drosophila_2:1622915_at:185:399; Interrogation_Position=789; Antisense; GACAAATTGGATGCTGCCGGCTATC
>probe:Drosophila_2:1622915_at:573:317; Interrogation_Position=804; Antisense; GCCGGCTATCGTCATATTTCACGGA
>probe:Drosophila_2:1622915_at:149:607; Interrogation_Position=853; Antisense; TGAGTCGCAAATCCAATGTCCAGAA
>probe:Drosophila_2:1622915_at:298:229; Interrogation_Position=867; Antisense; AATGTCCAGAATCCTGTCCAACAAC
>probe:Drosophila_2:1622915_at:660:481; Interrogation_Position=951; Antisense; GTATTGCAAATACCCCGGATAGCTG
>probe:Drosophila_2:1622915_at:435:463; Interrogation_Position=978; Antisense; GATTCGGACACGGAATTGGACTCCA
>probe:Drosophila_2:1622915_at:310:727; Interrogation_Position=993; Antisense; TTGGACTCCAATCCGGACAATATGC

Paste this into a BLAST search page for me
AATATTCAAGGACGATCCAGCCCCAATATATTCATTTTGTGTCCCTCGTCCTCGTCCCGCGCATAAATTTTATTGGAACATCTCTGAACTTTAGGGCTATTAGGGCTATTTTCCAACATTGCATGTTGGGTGCGGTTTTCAATTCACATTAATTCACATTGTACCGGGCATGAGTGACAAATTGGATGCTGCCGGCTATCGCCGGCTATCGTCATATTTCACGGATGAGTCGCAAATCCAATGTCCAGAAAATGTCCAGAATCCTGTCCAACAACGTATTGCAAATACCCCGGATAGCTGGATTCGGACACGGAATTGGACTCCATTGGACTCCAATCCGGACAATATGC

Full Affymetrix probeset data:

Annotations for 1622915_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720