FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622916_at:

>probe:Drosophila_2:1622916_at:709:693; Interrogation_Position=450; Antisense; TTTCGGTCCGCAAGCTGGTAATTTT
>probe:Drosophila_2:1622916_at:237:655; Interrogation_Position=468; Antisense; TAATTTTGCCCAGCCAGGTGGTTTC
>probe:Drosophila_2:1622916_at:565:159; Interrogation_Position=537; Antisense; ACAAGGCATCCCTGGCAATGGATTC
>probe:Drosophila_2:1622916_at:317:229; Interrogation_Position=553; Antisense; AATGGATTCCCAACGCAAGGAGCTC
>probe:Drosophila_2:1622916_at:547:603; Interrogation_Position=599; Antisense; TGTTCCCATCACAAGGAGGTGCCTT
>probe:Drosophila_2:1622916_at:721:359; Interrogation_Position=635; Antisense; GAATACCGGGCAATGGTTTCCTAGG
>probe:Drosophila_2:1622916_at:366:675; Interrogation_Position=656; Antisense; TAGGAGGTAACTTCCCGCCACAGGG
>probe:Drosophila_2:1622916_at:334:683; Interrogation_Position=703; Antisense; TATCCACCGGAGTTCTTGACAAACC
>probe:Drosophila_2:1622916_at:349:225; Interrogation_Position=764; Antisense; AAGGACCCAGTCCAGCAGGATTCAA
>probe:Drosophila_2:1622916_at:167:79; Interrogation_Position=780; Antisense; AGGATTCAATGTGCCCGCAGGATTC
>probe:Drosophila_2:1622916_at:503:313; Interrogation_Position=821; Antisense; GCCAGAATCCCTACCAACAATTTGG
>probe:Drosophila_2:1622916_at:437:41; Interrogation_Position=939; Antisense; ATCGGCCGACGATCCCAAGAGTGTG
>probe:Drosophila_2:1622916_at:677:573; Interrogation_Position=963; Antisense; GGCGGATACGGTTTACGCATCCAAT
>probe:Drosophila_2:1622916_at:386:47; Interrogation_Position=981; Antisense; ATCCAATGGCGGCTATGTCTACAAG

Paste this into a BLAST search page for me
TTTCGGTCCGCAAGCTGGTAATTTTTAATTTTGCCCAGCCAGGTGGTTTCACAAGGCATCCCTGGCAATGGATTCAATGGATTCCCAACGCAAGGAGCTCTGTTCCCATCACAAGGAGGTGCCTTGAATACCGGGCAATGGTTTCCTAGGTAGGAGGTAACTTCCCGCCACAGGGTATCCACCGGAGTTCTTGACAAACCAAGGACCCAGTCCAGCAGGATTCAAAGGATTCAATGTGCCCGCAGGATTCGCCAGAATCCCTACCAACAATTTGGATCGGCCGACGATCCCAAGAGTGTGGGCGGATACGGTTTACGCATCCAATATCCAATGGCGGCTATGTCTACAAG

Full Affymetrix probeset data:

Annotations for 1622916_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720