Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622917_a_at:

>probe:Drosophila_2:1622917_a_at:247:221; Interrogation_Position=146; Antisense; AAGTGCACTTTATCATCGCCATGGG
>probe:Drosophila_2:1622917_a_at:318:419; Interrogation_Position=170; Antisense; GAGCATCGACAGTTAAGCCCTTTTC
>probe:Drosophila_2:1622917_a_at:393:123; Interrogation_Position=185; Antisense; AGCCCTTTTCTGAAGCGGAATGCAA
>probe:Drosophila_2:1622917_a_at:4:211; Interrogation_Position=238; Antisense; AAGAAGCATCATGCCGACCTAGACG
>probe:Drosophila_2:1622917_a_at:427:491; Interrogation_Position=355; Antisense; GTAAAAAGAATGTTGCCGGCCGCCA
>probe:Drosophila_2:1622917_a_at:383:375; Interrogation_Position=402; Antisense; GAAGAAAGCAGTCCCCAAATGGCGT
>probe:Drosophila_2:1622917_a_at:79:311; Interrogation_Position=416; Antisense; CCAAATGGCGTTATCGTTCGAGGAA
>probe:Drosophila_2:1622917_a_at:20:73; Interrogation_Position=436; Antisense; AGGAAAAGACCCATGGCCAAGCCCA
>probe:Drosophila_2:1622917_a_at:14:135; Interrogation_Position=460; Antisense; ACGCCAAATCCCAATAATCCTGCAA
>probe:Drosophila_2:1622917_a_at:206:33; Interrogation_Position=473; Antisense; ATAATCCTGCAATGAGCACCGCGTT
>probe:Drosophila_2:1622917_a_at:316:419; Interrogation_Position=486; Antisense; GAGCACCGCGTTCATTGGATTTTTG
>probe:Drosophila_2:1622917_a_at:588:541; Interrogation_Position=502; Antisense; GGATTTTTGCGCGAGTACCAAAGGA
>probe:Drosophila_2:1622917_a_at:15:75; Interrogation_Position=523; Antisense; AGGAGGAACACCATCGTAGACGTAA
>probe:Drosophila_2:1622917_a_at:721:45; Interrogation_Position=630; Antisense; ATGCCTAAATTTCCAAAACCCTGAT

Paste this into a BLAST search page for me
AAGTGCACTTTATCATCGCCATGGGGAGCATCGACAGTTAAGCCCTTTTCAGCCCTTTTCTGAAGCGGAATGCAAAAGAAGCATCATGCCGACCTAGACGGTAAAAAGAATGTTGCCGGCCGCCAGAAGAAAGCAGTCCCCAAATGGCGTCCAAATGGCGTTATCGTTCGAGGAAAGGAAAAGACCCATGGCCAAGCCCAACGCCAAATCCCAATAATCCTGCAAATAATCCTGCAATGAGCACCGCGTTGAGCACCGCGTTCATTGGATTTTTGGGATTTTTGCGCGAGTACCAAAGGAAGGAGGAACACCATCGTAGACGTAAATGCCTAAATTTCCAAAACCCTGAT

Full Affymetrix probeset data:

Annotations for 1622917_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime