FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622919_at:

>probe:Drosophila_2:1622919_at:578:149; Interrogation_Position=296; Antisense; ACAAGGAACGTCACATCACCGTCGG
>probe:Drosophila_2:1622919_at:613:505; Interrogation_Position=322; Antisense; GTGCCCAAGCGCAACTACAACGTGG
>probe:Drosophila_2:1622919_at:440:297; Interrogation_Position=362; Antisense; CGCAGCGCAACAACAGGAAGACCAT
>probe:Drosophila_2:1622919_at:511:73; Interrogation_Position=376; Antisense; AGGAAGACCATCAAGATCAGCCCCG
>probe:Drosophila_2:1622919_at:538:173; Interrogation_Position=449; Antisense; AAAGCGACTTGAACGCCGAGGTAGT
>probe:Drosophila_2:1622919_at:231:159; Interrogation_Position=521; Antisense; ACAAGACCAACGAAGAGGCCGCCCA
>probe:Drosophila_2:1622919_at:81:115; Interrogation_Position=551; Antisense; AGCAGCAGATCCAAGCCCAGTACGA
>probe:Drosophila_2:1622919_at:419:305; Interrogation_Position=567; Antisense; CCAGTACGACGCTCTGGGCGGCAGT
>probe:Drosophila_2:1622919_at:366:549; Interrogation_Position=610; Antisense; GGAGTGGCCCCAGTCACATCCGTGA
>probe:Drosophila_2:1622919_at:549:493; Interrogation_Position=622; Antisense; GTCACATCCGTGATTGGAGCGCTGG
>probe:Drosophila_2:1622919_at:122:85; Interrogation_Position=652; Antisense; AGTGACGGTCACATCGACGGCGGAT
>probe:Drosophila_2:1622919_at:298:311; Interrogation_Position=688; Antisense; GCCACAGGAGCTGGTCAGATCGTCT
>probe:Drosophila_2:1622919_at:500:317; Interrogation_Position=724; Antisense; GCCGGATCGCACACGGGCAATGCAT
>probe:Drosophila_2:1622919_at:713:359; Interrogation_Position=740; Antisense; GCAATGCATACCTGCCACCCAATTT

Paste this into a BLAST search page for me
ACAAGGAACGTCACATCACCGTCGGGTGCCCAAGCGCAACTACAACGTGGCGCAGCGCAACAACAGGAAGACCATAGGAAGACCATCAAGATCAGCCCCGAAAGCGACTTGAACGCCGAGGTAGTACAAGACCAACGAAGAGGCCGCCCAAGCAGCAGATCCAAGCCCAGTACGACCAGTACGACGCTCTGGGCGGCAGTGGAGTGGCCCCAGTCACATCCGTGAGTCACATCCGTGATTGGAGCGCTGGAGTGACGGTCACATCGACGGCGGATGCCACAGGAGCTGGTCAGATCGTCTGCCGGATCGCACACGGGCAATGCATGCAATGCATACCTGCCACCCAATTT

Full Affymetrix probeset data:

Annotations for 1622919_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720