Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622920_at:

>probe:Drosophila_2:1622920_at:251:229; Interrogation_Position=3551; Antisense; AATGGAGCAGCCAAGAGCGCAGCTC
>probe:Drosophila_2:1622920_at:476:715; Interrogation_Position=3586; Antisense; TTCGGATGCCAAGCCGGATTCCAAA
>probe:Drosophila_2:1622920_at:329:553; Interrogation_Position=3629; Antisense; GGAGCACCAGAAGCAACTAAGGCAA
>probe:Drosophila_2:1622920_at:117:225; Interrogation_Position=3707; Antisense; AAGGCTGCAGGAGACTCCAAGCCAG
>probe:Drosophila_2:1622920_at:304:629; Interrogation_Position=3722; Antisense; TCCAAGCCAGGAGACGATGCCAAGG
>probe:Drosophila_2:1622920_at:399:389; Interrogation_Position=3757; Antisense; GAAACCCGGCGACGATAAGGACAAG
>probe:Drosophila_2:1622920_at:563:559; Interrogation_Position=3775; Antisense; GGACAAGAAACCTGGCGACGACAAA
>probe:Drosophila_2:1622920_at:264:379; Interrogation_Position=3829; Antisense; GAAGCCAGCCGATGACAAGGACAAG
>probe:Drosophila_2:1622920_at:565:559; Interrogation_Position=3919; Antisense; GGACAAGAAGCCTGCCGATGACAAG
>probe:Drosophila_2:1622920_at:280:383; Interrogation_Position=4016; Antisense; GAACGAGGCAAATCCACGGTCACAG
>probe:Drosophila_2:1622920_at:41:155; Interrogation_Position=4037; Antisense; ACAGGACGCATGATCTCCGGCTGGC
>probe:Drosophila_2:1622920_at:240:573; Interrogation_Position=4055; Antisense; GGCTGGCTCTAAGCCGCGGAATCCA
>probe:Drosophila_2:1622920_at:144:299; Interrogation_Position=4069; Antisense; CGCGGAATCCACTTTCATAGCAATT
>probe:Drosophila_2:1622920_at:545:657; Interrogation_Position=4101; Antisense; TAAGTCCTTTGTTTGTGTGAATAAT

Paste this into a BLAST search page for me
AATGGAGCAGCCAAGAGCGCAGCTCTTCGGATGCCAAGCCGGATTCCAAAGGAGCACCAGAAGCAACTAAGGCAAAAGGCTGCAGGAGACTCCAAGCCAGTCCAAGCCAGGAGACGATGCCAAGGGAAACCCGGCGACGATAAGGACAAGGGACAAGAAACCTGGCGACGACAAAGAAGCCAGCCGATGACAAGGACAAGGGACAAGAAGCCTGCCGATGACAAGGAACGAGGCAAATCCACGGTCACAGACAGGACGCATGATCTCCGGCTGGCGGCTGGCTCTAAGCCGCGGAATCCACGCGGAATCCACTTTCATAGCAATTTAAGTCCTTTGTTTGTGTGAATAAT

Full Affymetrix probeset data:

Annotations for 1622920_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime