Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622921_at:

>probe:Drosophila_2:1622921_at:233:561; Interrogation_Position=353; Antisense; GGAACTCCGCGGAAATTCGGCAGTT
>probe:Drosophila_2:1622921_at:540:105; Interrogation_Position=380; Antisense; AGACAGAACTGGACGATGCCCGGAA
>probe:Drosophila_2:1622921_at:298:271; Interrogation_Position=456; Antisense; CATCAAAATTATGCGCGCCGAGCGT
>probe:Drosophila_2:1622921_at:319:271; Interrogation_Position=546; Antisense; CATCGATACGGCCATGTTCTACGGA
>probe:Drosophila_2:1622921_at:82:671; Interrogation_Position=565; Antisense; TACGGATCTAAGGTGCTGCTCTCAG
>probe:Drosophila_2:1622921_at:475:283; Interrogation_Position=580; Antisense; CTGCTCTCAGCAATAACCGTGTTTA
>probe:Drosophila_2:1622921_at:189:515; Interrogation_Position=598; Antisense; GTGTTTATCAGCATCCGGAATCGTG
>probe:Drosophila_2:1622921_at:333:565; Interrogation_Position=614; Antisense; GGAATCGTGGAACGCCCGTCATGAT
>probe:Drosophila_2:1622921_at:530:701; Interrogation_Position=680; Antisense; TTAGTTTTCCTACTGGCGTGGCCAA
>probe:Drosophila_2:1622921_at:529:717; Interrogation_Position=749; Antisense; TTCGACTCATCTACGGCTTTGTGAA
>probe:Drosophila_2:1622921_at:677:523; Interrogation_Position=782; Antisense; GGGCGTGATTCCATCCGAGCGAAAT
>probe:Drosophila_2:1622921_at:650:43; Interrogation_Position=805; Antisense; ATCCCTCCATTTCATTTAGCACTTA
>probe:Drosophila_2:1622921_at:396:71; Interrogation_Position=832; Antisense; AGGCGCTCGAAACTATGTACTTTGT
>probe:Drosophila_2:1622921_at:479:207; Interrogation_Position=868; Antisense; AAGCTTCATCATGCATTGACTCTTG

Paste this into a BLAST search page for me
GGAACTCCGCGGAAATTCGGCAGTTAGACAGAACTGGACGATGCCCGGAACATCAAAATTATGCGCGCCGAGCGTCATCGATACGGCCATGTTCTACGGATACGGATCTAAGGTGCTGCTCTCAGCTGCTCTCAGCAATAACCGTGTTTAGTGTTTATCAGCATCCGGAATCGTGGGAATCGTGGAACGCCCGTCATGATTTAGTTTTCCTACTGGCGTGGCCAATTCGACTCATCTACGGCTTTGTGAAGGGCGTGATTCCATCCGAGCGAAATATCCCTCCATTTCATTTAGCACTTAAGGCGCTCGAAACTATGTACTTTGTAAGCTTCATCATGCATTGACTCTTG

Full Affymetrix probeset data:

Annotations for 1622921_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime