Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622922_at:

>probe:Drosophila_2:1622922_at:685:697; Interrogation_Position=1792; Antisense; TTTAAGCGGGAAATCCACGCCCTGG
>probe:Drosophila_2:1622922_at:677:621; Interrogation_Position=1855; Antisense; TGCGACGAGCAGTGGACGAACTCCT
>probe:Drosophila_2:1622922_at:261:269; Interrogation_Position=1960; Antisense; CATGCCACCGGAAACGGGCCTGGAA
>probe:Drosophila_2:1622922_at:385:519; Interrogation_Position=1975; Antisense; GGGCCTGGAAACTCCAGCGCTGGCA
>probe:Drosophila_2:1622922_at:649:287; Interrogation_Position=1994; Antisense; CTGGCAGCAGCGGTATTGTCAAAAT
>probe:Drosophila_2:1622922_at:683:479; Interrogation_Position=2006; Antisense; GTATTGTCAAAATGGCGGCGGCGCC
>probe:Drosophila_2:1622922_at:609:287; Interrogation_Position=2030; Antisense; CTGGAAAGCGAAGCGAGCGGCTCAA
>probe:Drosophila_2:1622922_at:158:209; Interrogation_Position=2053; Antisense; AAGCAGCAGCACCATGTGCGCTTTT
>probe:Drosophila_2:1622922_at:676:503; Interrogation_Position=2068; Antisense; GTGCGCTTTTCCGACGAGAAGAACT
>probe:Drosophila_2:1622922_at:624:211; Interrogation_Position=2086; Antisense; AAGAACTTCTCGGACTGAGAGGGAA
>probe:Drosophila_2:1622922_at:67:435; Interrogation_Position=2104; Antisense; GAGGGAAAACCAACTACTAGACTGC
>probe:Drosophila_2:1622922_at:209:147; Interrogation_Position=2119; Antisense; ACTAGACTGCACCTAATCTCTGTTT
>probe:Drosophila_2:1622922_at:648:37; Interrogation_Position=2134; Antisense; ATCTCTGTTTAGTCATAGGCTAACC
>probe:Drosophila_2:1622922_at:649:641; Interrogation_Position=2146; Antisense; TCATAGGCTAACCATTTTTTCCCCT

Paste this into a BLAST search page for me
TTTAAGCGGGAAATCCACGCCCTGGTGCGACGAGCAGTGGACGAACTCCTCATGCCACCGGAAACGGGCCTGGAAGGGCCTGGAAACTCCAGCGCTGGCACTGGCAGCAGCGGTATTGTCAAAATGTATTGTCAAAATGGCGGCGGCGCCCTGGAAAGCGAAGCGAGCGGCTCAAAAGCAGCAGCACCATGTGCGCTTTTGTGCGCTTTTCCGACGAGAAGAACTAAGAACTTCTCGGACTGAGAGGGAAGAGGGAAAACCAACTACTAGACTGCACTAGACTGCACCTAATCTCTGTTTATCTCTGTTTAGTCATAGGCTAACCTCATAGGCTAACCATTTTTTCCCCT

Full Affymetrix probeset data:

Annotations for 1622922_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime