FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622923_at:

>probe:Drosophila_2:1622923_at:647:717; Interrogation_Position=1532; Antisense; TTCCGTTTTGGCCAGAAATAGCTTT
>probe:Drosophila_2:1622923_at:40:633; Interrogation_Position=1550; Antisense; TAGCTTTGGTTGGAGCGACAATAGC
>probe:Drosophila_2:1622923_at:721:719; Interrogation_Position=1588; Antisense; TTGCCACAGGCGGAGAAGTTGAACT
>probe:Drosophila_2:1622923_at:473:383; Interrogation_Position=1608; Antisense; GAACTGCCCAACTACTCGACTGAAT
>probe:Drosophila_2:1622923_at:342:553; Interrogation_Position=1634; Antisense; GGAGCTTCAGGACGATTTTACCGAA
>probe:Drosophila_2:1622923_at:108:437; Interrogation_Position=1659; Antisense; GAGGACTTCCACAACGAAATCACCC
>probe:Drosophila_2:1622923_at:251:427; Interrogation_Position=1685; Antisense; GAGATCTGAGGTTCTATCGGCCAGC
>probe:Drosophila_2:1622923_at:124:41; Interrogation_Position=1700; Antisense; ATCGGCCAGCATGATGTTCAACTCG
>probe:Drosophila_2:1622923_at:487:709; Interrogation_Position=1716; Antisense; TTCAACTCGGGCTCGGTTAATGGGC
>probe:Drosophila_2:1622923_at:55:575; Interrogation_Position=1743; Antisense; GGCGGAATCAGTGCCTTTATATATT
>probe:Drosophila_2:1622923_at:181:151; Interrogation_Position=1835; Antisense; ACATTCAATGTTAGCGATAGCGCAT
>probe:Drosophila_2:1622923_at:548:427; Interrogation_Position=1913; Antisense; GAGATAACATTTTTCTGAGCAGTGT
>probe:Drosophila_2:1622923_at:405:493; Interrogation_Position=1955; Antisense; GTAATGCTGGTGACTATGATACTAT
>probe:Drosophila_2:1622923_at:24:257; Interrogation_Position=2014; Antisense; CAAACGATGGCATTTCCTTTTTCTA

Paste this into a BLAST search page for me
TTCCGTTTTGGCCAGAAATAGCTTTTAGCTTTGGTTGGAGCGACAATAGCTTGCCACAGGCGGAGAAGTTGAACTGAACTGCCCAACTACTCGACTGAATGGAGCTTCAGGACGATTTTACCGAAGAGGACTTCCACAACGAAATCACCCGAGATCTGAGGTTCTATCGGCCAGCATCGGCCAGCATGATGTTCAACTCGTTCAACTCGGGCTCGGTTAATGGGCGGCGGAATCAGTGCCTTTATATATTACATTCAATGTTAGCGATAGCGCATGAGATAACATTTTTCTGAGCAGTGTGTAATGCTGGTGACTATGATACTATCAAACGATGGCATTTCCTTTTTCTA

Full Affymetrix probeset data:

Annotations for 1622923_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720