FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622924_at:

>probe:Drosophila_2:1622924_at:530:609; Interrogation_Position=108; Antisense; TGAGCGCATTTCAAGGTCGGAATTC
>probe:Drosophila_2:1622924_at:420:1; Interrogation_Position=128; Antisense; AATTCGGGTTTTCAGGCACATTCTT
>probe:Drosophila_2:1622924_at:111:59; Interrogation_Position=13; Antisense; ATGGTTTATTGTTTCCAGCCCAACT
>probe:Drosophila_2:1622924_at:480:321; Interrogation_Position=192; Antisense; GCGTATTCTGAGCAGTTACTCCGGT
>probe:Drosophila_2:1622924_at:413:657; Interrogation_Position=208; Antisense; TACTCCGGTGACGAGTCCGATTACA
>probe:Drosophila_2:1622924_at:161:631; Interrogation_Position=223; Antisense; TCCGATTACAAACTGACTCCCATGT
>probe:Drosophila_2:1622924_at:661:223; Interrogation_Position=292; Antisense; AAGGACCTGTTGTTGCCGAATCTGG
>probe:Drosophila_2:1622924_at:721:365; Interrogation_Position=309; Antisense; GAATCTGGGCAATTGCACCGATTTG
>probe:Drosophila_2:1622924_at:706:131; Interrogation_Position=325; Antisense; ACCGATTTGCCCGTCTATGAAAATG
>probe:Drosophila_2:1622924_at:70:387; Interrogation_Position=343; Antisense; GAAAATGAATTTGTACCACCCTGGC
>probe:Drosophila_2:1622924_at:233:549; Interrogation_Position=39; Antisense; GGAGGCAACGCCATTGTCGATTGGT
>probe:Drosophila_2:1622924_at:668:335; Interrogation_Position=392; Antisense; GCTGCGCTCTGAACGGCCAAGGATT
>probe:Drosophila_2:1622924_at:400:257; Interrogation_Position=473; Antisense; CAAATCTTGAAGTCACCGTGTCCGT
>probe:Drosophila_2:1622924_at:288:515; Interrogation_Position=490; Antisense; GTGTCCGTCGTTCTGCGGATCAGAA

Paste this into a BLAST search page for me
TGAGCGCATTTCAAGGTCGGAATTCAATTCGGGTTTTCAGGCACATTCTTATGGTTTATTGTTTCCAGCCCAACTGCGTATTCTGAGCAGTTACTCCGGTTACTCCGGTGACGAGTCCGATTACATCCGATTACAAACTGACTCCCATGTAAGGACCTGTTGTTGCCGAATCTGGGAATCTGGGCAATTGCACCGATTTGACCGATTTGCCCGTCTATGAAAATGGAAAATGAATTTGTACCACCCTGGCGGAGGCAACGCCATTGTCGATTGGTGCTGCGCTCTGAACGGCCAAGGATTCAAATCTTGAAGTCACCGTGTCCGTGTGTCCGTCGTTCTGCGGATCAGAA

Full Affymetrix probeset data:

Annotations for 1622924_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720