Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622925_at:

>probe:Drosophila_2:1622925_at:625:413; Interrogation_Position=10081; Antisense; GACCAGCTGACCAAGTTTGTGGAGC
>probe:Drosophila_2:1622925_at:49:521; Interrogation_Position=10099; Antisense; GTGGAGCGACTCTAGTGCAGCAACA
>probe:Drosophila_2:1622925_at:18:129; Interrogation_Position=10144; Antisense; ACCACCACCAGCTACAATGGTTGGT
>probe:Drosophila_2:1622925_at:513:615; Interrogation_Position=10208; Antisense; TGAATGAGTGTCCAGTAGCCGCAGA
>probe:Drosophila_2:1622925_at:29:439; Interrogation_Position=10236; Antisense; GATGACGACGAAGACCAACCGGCAG
>probe:Drosophila_2:1622925_at:407:249; Interrogation_Position=10251; Antisense; CAACCGGCAGGGATAACCAGTGTGT
>probe:Drosophila_2:1622925_at:158:655; Interrogation_Position=10322; Antisense; TTTAAACGGCACCACAAATAATTGT
>probe:Drosophila_2:1622925_at:367:243; Interrogation_Position=10370; Antisense; AATATCGCGCCTAATGTGTACTGTA
>probe:Drosophila_2:1622925_at:640:443; Interrogation_Position=10401; Antisense; GATGACCCACCATTACAACCACTAA
>probe:Drosophila_2:1622925_at:77:377; Interrogation_Position=10462; Antisense; GACAGAGCATTATGATTCGATTTCC
>probe:Drosophila_2:1622925_at:396:11; Interrogation_Position=10476; Antisense; ATTCGATTTCCATTTTATGTCCGCG
>probe:Drosophila_2:1622925_at:479:699; Interrogation_Position=10489; Antisense; TTTATGTCCGCGATTTAGCAAATAT
>probe:Drosophila_2:1622925_at:608:1; Interrogation_Position=10565; Antisense; ATTAATGCGATTCCTTCGTTTCCAC
>probe:Drosophila_2:1622925_at:513:9; Interrogation_Position=10574; Antisense; ATTCCTTCGTTTCCACTAAGCAGAT

Paste this into a BLAST search page for me
GACCAGCTGACCAAGTTTGTGGAGCGTGGAGCGACTCTAGTGCAGCAACAACCACCACCAGCTACAATGGTTGGTTGAATGAGTGTCCAGTAGCCGCAGAGATGACGACGAAGACCAACCGGCAGCAACCGGCAGGGATAACCAGTGTGTTTTAAACGGCACCACAAATAATTGTAATATCGCGCCTAATGTGTACTGTAGATGACCCACCATTACAACCACTAAGACAGAGCATTATGATTCGATTTCCATTCGATTTCCATTTTATGTCCGCGTTTATGTCCGCGATTTAGCAAATATATTAATGCGATTCCTTCGTTTCCACATTCCTTCGTTTCCACTAAGCAGAT

Full Affymetrix probeset data:

Annotations for 1622925_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime