FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622926_at:

>probe:Drosophila_2:1622926_at:691:423; Interrogation_Position=2303; Antisense; GAGAGCCCTGGAGCAAAGCTTCGAA
>probe:Drosophila_2:1622926_at:280:221; Interrogation_Position=2340; Antisense; AAGTGGACGGACTTCGAGCACGCCT
>probe:Drosophila_2:1622926_at:405:291; Interrogation_Position=2380; Antisense; CGCGGACTTCTCCAGAGTTGTTGAA
>probe:Drosophila_2:1622926_at:258:127; Interrogation_Position=2405; Antisense; ACTCTACGAAGATTACCTCAAACGG
>probe:Drosophila_2:1622926_at:327:163; Interrogation_Position=2551; Antisense; AAATTACCATGTTATTAGCTCTCCA
>probe:Drosophila_2:1622926_at:281:707; Interrogation_Position=2565; Antisense; TTAGCTCTCCAAAATCTGTTCACTC
>probe:Drosophila_2:1622926_at:635:165; Interrogation_Position=2576; Antisense; AAATCTGTTCACTCGATCAGCCTTC
>probe:Drosophila_2:1622926_at:142:35; Interrogation_Position=2591; Antisense; ATCAGCCTTCAAATCGGAGTTATGT
>probe:Drosophila_2:1622926_at:558:525; Interrogation_Position=2655; Antisense; GGGTCGACTTTGGTGTTTAGACAGT
>probe:Drosophila_2:1622926_at:187:397; Interrogation_Position=2683; Antisense; GAAATTCATATTTAGTGCCTGCAGA
>probe:Drosophila_2:1622926_at:570:85; Interrogation_Position=2696; Antisense; AGTGCCTGCAGATTAGACTACAAAG
>probe:Drosophila_2:1622926_at:38:43; Interrogation_Position=2743; Antisense; ATCGGTGATAACTTGAATGCTCTAT
>probe:Drosophila_2:1622926_at:64:369; Interrogation_Position=2757; Antisense; GAATGCTCTATTTTTAACCTCTAAA
>probe:Drosophila_2:1622926_at:563:429; Interrogation_Position=2788; Antisense; GAGTATCATTCTCTCGATTGTGAAT

Paste this into a BLAST search page for me
GAGAGCCCTGGAGCAAAGCTTCGAAAAGTGGACGGACTTCGAGCACGCCTCGCGGACTTCTCCAGAGTTGTTGAAACTCTACGAAGATTACCTCAAACGGAAATTACCATGTTATTAGCTCTCCATTAGCTCTCCAAAATCTGTTCACTCAAATCTGTTCACTCGATCAGCCTTCATCAGCCTTCAAATCGGAGTTATGTGGGTCGACTTTGGTGTTTAGACAGTGAAATTCATATTTAGTGCCTGCAGAAGTGCCTGCAGATTAGACTACAAAGATCGGTGATAACTTGAATGCTCTATGAATGCTCTATTTTTAACCTCTAAAGAGTATCATTCTCTCGATTGTGAAT

Full Affymetrix probeset data:

Annotations for 1622926_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720