FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622927_at:

>probe:Drosophila_2:1622927_at:13:121; Interrogation_Position=1016; Antisense; AGCTGAAGGATCTGCCTCGGCCGAT
>probe:Drosophila_2:1622927_at:654:585; Interrogation_Position=515; Antisense; TGGATGGATCTGTGAACTTCTACCG
>probe:Drosophila_2:1622927_at:589:191; Interrogation_Position=529; Antisense; AACTTCTACCGGAACTGGGATGCCT
>probe:Drosophila_2:1622927_at:136:575; Interrogation_Position=580; Antisense; GGCGAGTTCTTCATCGGTTTGGAGA
>probe:Drosophila_2:1622927_at:158:481; Interrogation_Position=596; Antisense; GTTTGGAGAAGCTGCACCGTCTGAC
>probe:Drosophila_2:1622927_at:505:125; Interrogation_Position=629; Antisense; AGCCCCACGAGCTGTACATTAGCAT
>probe:Drosophila_2:1622927_at:643:409; Interrogation_Position=691; Antisense; GACGACTTCCTCATCGGCAGTGAAG
>probe:Drosophila_2:1622927_at:527:671; Interrogation_Position=724; Antisense; TACGAACTGAAGCTACTGGGCCATT
>probe:Drosophila_2:1622927_at:251:397; Interrogation_Position=784; Antisense; GACAAGATGAAGTTCTCCACCTACG
>probe:Drosophila_2:1622927_at:503:671; Interrogation_Position=805; Antisense; TACGACCGGGACAATGACGCCTTCA
>probe:Drosophila_2:1622927_at:48:417; Interrogation_Position=860; Antisense; GAGCCTGGTGGTACGACTTCTGTTC
>probe:Drosophila_2:1622927_at:279:427; Interrogation_Position=917; Antisense; GAGAGGTGGACAACCCGCAGAGCAT
>probe:Drosophila_2:1622927_at:99:117; Interrogation_Position=937; Antisense; AGCATCTACTGGGAGCCGTGGTACA
>probe:Drosophila_2:1622927_at:376:615; Interrogation_Position=974; Antisense; TGAAGTCCGTCCAAATGCTCATCCG

Paste this into a BLAST search page for me
AGCTGAAGGATCTGCCTCGGCCGATTGGATGGATCTGTGAACTTCTACCGAACTTCTACCGGAACTGGGATGCCTGGCGAGTTCTTCATCGGTTTGGAGAGTTTGGAGAAGCTGCACCGTCTGACAGCCCCACGAGCTGTACATTAGCATGACGACTTCCTCATCGGCAGTGAAGTACGAACTGAAGCTACTGGGCCATTGACAAGATGAAGTTCTCCACCTACGTACGACCGGGACAATGACGCCTTCAGAGCCTGGTGGTACGACTTCTGTTCGAGAGGTGGACAACCCGCAGAGCATAGCATCTACTGGGAGCCGTGGTACATGAAGTCCGTCCAAATGCTCATCCG

Full Affymetrix probeset data:

Annotations for 1622927_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720