Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622928_at:

>probe:Drosophila_2:1622928_at:718:185; Interrogation_Position=1790; Antisense; AACACCGATGGCAACTCCAATGTTC
>probe:Drosophila_2:1622928_at:283:385; Interrogation_Position=1861; Antisense; GAACATTCGCGTGCCGGAGGTTCTA
>probe:Drosophila_2:1622928_at:353:691; Interrogation_Position=1884; Antisense; TATTCCAGCCCAGCATGATTGGTTG
>probe:Drosophila_2:1622928_at:370:113; Interrogation_Position=1968; Antisense; AGCAGCAGCGCCTGGTTGAGCACGT
>probe:Drosophila_2:1622928_at:108:717; Interrogation_Position=1983; Antisense; TTGAGCACGTGTACCTAACCGGCGG
>probe:Drosophila_2:1622928_at:286:653; Interrogation_Position=1998; Antisense; TAACCGGCGGTTGTGCCCAATTCAA
>probe:Drosophila_2:1622928_at:412:553; Interrogation_Position=2047; Antisense; GGAGCTCATGGAAATGCGACCGTTT
>probe:Drosophila_2:1622928_at:278:405; Interrogation_Position=2064; Antisense; GACCGTTTCAATCAAAGTTCGCCAT
>probe:Drosophila_2:1622928_at:451:169; Interrogation_Position=2077; Antisense; AAAGTTCGCCATCTACGAGTCGGAT
>probe:Drosophila_2:1622928_at:706:499; Interrogation_Position=2095; Antisense; GTCGGATGAGCCAACTTTAAGCGCC
>probe:Drosophila_2:1622928_at:100:149; Interrogation_Position=2108; Antisense; ACTTTAAGCGCCTGGCTGGGAGCAT
>probe:Drosophila_2:1622928_at:677:63; Interrogation_Position=2131; Antisense; ATGTGTGCACGCAGGAGAGCCCACC
>probe:Drosophila_2:1622928_at:265:429; Interrogation_Position=2204; Antisense; GAGTTCTTTCGGGAGCACACAGCTA
>probe:Drosophila_2:1622928_at:287:111; Interrogation_Position=2228; Antisense; AGCAATATCTTTTATCCTACACCAA

Paste this into a BLAST search page for me
AACACCGATGGCAACTCCAATGTTCGAACATTCGCGTGCCGGAGGTTCTATATTCCAGCCCAGCATGATTGGTTGAGCAGCAGCGCCTGGTTGAGCACGTTTGAGCACGTGTACCTAACCGGCGGTAACCGGCGGTTGTGCCCAATTCAAGGAGCTCATGGAAATGCGACCGTTTGACCGTTTCAATCAAAGTTCGCCATAAAGTTCGCCATCTACGAGTCGGATGTCGGATGAGCCAACTTTAAGCGCCACTTTAAGCGCCTGGCTGGGAGCATATGTGTGCACGCAGGAGAGCCCACCGAGTTCTTTCGGGAGCACACAGCTAAGCAATATCTTTTATCCTACACCAA

Full Affymetrix probeset data:

Annotations for 1622928_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime