Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622931_at:

>probe:Drosophila_2:1622931_at:453:213; Interrogation_Position=5983; Antisense; AAGACCTTGGACGTTGATGACGGAG
>probe:Drosophila_2:1622931_at:285:685; Interrogation_Position=6030; Antisense; TATTAGCGACGATCTCAAGGAGGTT
>probe:Drosophila_2:1622931_at:72:175; Interrogation_Position=6060; Antisense; AAAGCCAGCCGAACAGCATGTGGTG
>probe:Drosophila_2:1622931_at:127:615; Interrogation_Position=6089; Antisense; TGAAGCCGCAGCTCCTTGTGGAGAC
>probe:Drosophila_2:1622931_at:648:551; Interrogation_Position=6108; Antisense; GGAGACCCAGTAGTAGATCCATCTT
>probe:Drosophila_2:1622931_at:221:449; Interrogation_Position=6123; Antisense; GATCCATCTTGCTAGCTTGATTTCT
>probe:Drosophila_2:1622931_at:240:437; Interrogation_Position=6192; Antisense; GAGGATCCTCAATGCCTACACAGAT
>probe:Drosophila_2:1622931_at:641:105; Interrogation_Position=6287; Antisense; AGAAGGTCGTTTTCGATTTATTCAG
>probe:Drosophila_2:1622931_at:233:13; Interrogation_Position=6306; Antisense; ATTCAGCTTTAGGTTTCTATGTCAT
>probe:Drosophila_2:1622931_at:254:641; Interrogation_Position=6345; Antisense; TCTGGGCCCACATTTATTGATTTCT
>probe:Drosophila_2:1622931_at:521:615; Interrogation_Position=6414; Antisense; TGAATTTACATTCGGCGTGCACATT
>probe:Drosophila_2:1622931_at:110:639; Interrogation_Position=6425; Antisense; TCGGCGTGCACATTATACATATTTG
>probe:Drosophila_2:1622931_at:240:517; Interrogation_Position=6532; Antisense; GTGTGGTGAGCATCTATAAGACTTT
>probe:Drosophila_2:1622931_at:34:33; Interrogation_Position=6547; Antisense; ATAAGACTTTGCGTGTTTGGTATCG

Paste this into a BLAST search page for me
AAGACCTTGGACGTTGATGACGGAGTATTAGCGACGATCTCAAGGAGGTTAAAGCCAGCCGAACAGCATGTGGTGTGAAGCCGCAGCTCCTTGTGGAGACGGAGACCCAGTAGTAGATCCATCTTGATCCATCTTGCTAGCTTGATTTCTGAGGATCCTCAATGCCTACACAGATAGAAGGTCGTTTTCGATTTATTCAGATTCAGCTTTAGGTTTCTATGTCATTCTGGGCCCACATTTATTGATTTCTTGAATTTACATTCGGCGTGCACATTTCGGCGTGCACATTATACATATTTGGTGTGGTGAGCATCTATAAGACTTTATAAGACTTTGCGTGTTTGGTATCG

Full Affymetrix probeset data:

Annotations for 1622931_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime