FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622933_at:

>probe:Drosophila_2:1622933_at:221:295; Interrogation_Position=585; Antisense; CCCATGTTACACCTGGTAACGGGCA
>probe:Drosophila_2:1622933_at:61:513; Interrogation_Position=589; Antisense; TGTTACACCTGGTAACGGGCAGTTT
>probe:Drosophila_2:1622933_at:486:659; Interrogation_Position=601; Antisense; TAACGGGCAGTTTTTGGACCAACAT
>probe:Drosophila_2:1622933_at:115:195; Interrogation_Position=602; Antisense; AACGGGCAGTTTTTGGACCAACATG
>probe:Drosophila_2:1622933_at:494:525; Interrogation_Position=605; Antisense; GGGCAGTTTTTGGACCAACATGTAC
>probe:Drosophila_2:1622933_at:60:479; Interrogation_Position=610; Antisense; GTTTTTGGACCAACATGTACCTGGT
>probe:Drosophila_2:1622933_at:486:587; Interrogation_Position=615; Antisense; TGGACCAACATGTACCTGGTCTTCT
>probe:Drosophila_2:1622933_at:605:127; Interrogation_Position=618; Antisense; ACCAACATGTACCTGGTCTTCTACA
>probe:Drosophila_2:1622933_at:319:189; Interrogation_Position=621; Antisense; AACATGTACCTGGTCTTCTACAGCT
>probe:Drosophila_2:1622933_at:320:61; Interrogation_Position=624; Antisense; ATGTACCTGGTCTTCTACAGCTTAA
>probe:Drosophila_2:1622933_at:25:489; Interrogation_Position=626; Antisense; GTACCTGGTCTTCTACAGCTTAAAT
>probe:Drosophila_2:1622933_at:327:537; Interrogation_Position=632; Antisense; GGTCTTCTACAGCTTAAATATTTTA
>probe:Drosophila_2:1622933_at:256:343; Interrogation_Position=643; Antisense; GCTTAAATATTTTAGCTCTGGCTTA
>probe:Drosophila_2:1622933_at:103:163; Interrogation_Position=647; Antisense; AAATATTTTAGCTCTGGCTTATGGA

Paste this into a BLAST search page for me
CCCATGTTACACCTGGTAACGGGCATGTTACACCTGGTAACGGGCAGTTTTAACGGGCAGTTTTTGGACCAACATAACGGGCAGTTTTTGGACCAACATGGGGCAGTTTTTGGACCAACATGTACGTTTTTGGACCAACATGTACCTGGTTGGACCAACATGTACCTGGTCTTCTACCAACATGTACCTGGTCTTCTACAAACATGTACCTGGTCTTCTACAGCTATGTACCTGGTCTTCTACAGCTTAAGTACCTGGTCTTCTACAGCTTAAATGGTCTTCTACAGCTTAAATATTTTAGCTTAAATATTTTAGCTCTGGCTTAAAATATTTTAGCTCTGGCTTATGGA

Full Affymetrix probeset data:

Annotations for 1622933_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720