Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622934_at:

>probe:Drosophila_2:1622934_at:485:163; Interrogation_Position=1459; Antisense; AAATATAGTCTCTTGTTTGCTAAGA
>probe:Drosophila_2:1622934_at:57:723; Interrogation_Position=1471; Antisense; TTGTTTGCTAAGAAGTGTCGCCCCT
>probe:Drosophila_2:1622934_at:392:685; Interrogation_Position=1474; Antisense; TTTGCTAAGAAGTGTCGCCCCTCGG
>probe:Drosophila_2:1622934_at:313:335; Interrogation_Position=1477; Antisense; GCTAAGAAGTGTCGCCCCTCGGGTA
>probe:Drosophila_2:1622934_at:619:449; Interrogation_Position=1487; Antisense; GTCGCCCCTCGGGTAAAGGAGCACG
>probe:Drosophila_2:1622934_at:681:301; Interrogation_Position=1490; Antisense; GCCCCTCGGGTAAAGGAGCACGCAG
>probe:Drosophila_2:1622934_at:608:169; Interrogation_Position=1501; Antisense; AAAGGAGCACGCAGTGGCACAACAC
>probe:Drosophila_2:1622934_at:164:553; Interrogation_Position=1504; Antisense; GGAGCACGCAGTGGCACAACACAGA
>probe:Drosophila_2:1622934_at:439:521; Interrogation_Position=1514; Antisense; GTGGCACAACACAGATGGCTTTCCG
>probe:Drosophila_2:1622934_at:303:357; Interrogation_Position=1517; Antisense; GCACAACACAGATGGCTTTCCGTGG
>probe:Drosophila_2:1622934_at:85:187; Interrogation_Position=1521; Antisense; AACACAGATGGCTTTCCGTGGCTTG
>probe:Drosophila_2:1622934_at:561:153; Interrogation_Position=1524; Antisense; ACAGATGGCTTTCCGTGGCTTGCCC
>probe:Drosophila_2:1622934_at:272:67; Interrogation_Position=1528; Antisense; ATGGCTTTCCGTGGCTTGCCCCGTT
>probe:Drosophila_2:1622934_at:642:577; Interrogation_Position=1564; Antisense; GGCCGCACGCGTTTTACTCTTATAA

Paste this into a BLAST search page for me
AAATATAGTCTCTTGTTTGCTAAGATTGTTTGCTAAGAAGTGTCGCCCCTTTTGCTAAGAAGTGTCGCCCCTCGGGCTAAGAAGTGTCGCCCCTCGGGTAGTCGCCCCTCGGGTAAAGGAGCACGGCCCCTCGGGTAAAGGAGCACGCAGAAAGGAGCACGCAGTGGCACAACACGGAGCACGCAGTGGCACAACACAGAGTGGCACAACACAGATGGCTTTCCGGCACAACACAGATGGCTTTCCGTGGAACACAGATGGCTTTCCGTGGCTTGACAGATGGCTTTCCGTGGCTTGCCCATGGCTTTCCGTGGCTTGCCCCGTTGGCCGCACGCGTTTTACTCTTATAA

Full Affymetrix probeset data:

Annotations for 1622934_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime