Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622937_at:

>probe:Drosophila_2:1622937_at:482:349; Interrogation_Position=1134; Antisense; GCAGGAGCGCTATGGCTTCAAGATA
>probe:Drosophila_2:1622937_at:449:525; Interrogation_Position=1164; Antisense; GGGCATTTCCTTCTATATACAGATT
>probe:Drosophila_2:1622937_at:411:693; Interrogation_Position=1200; Antisense; TTTGACAATTGCTCTGTTCGTGGCC
>probe:Drosophila_2:1622937_at:209:489; Interrogation_Position=1230; Antisense; GTACGATGTGATCTACTCGCGCAGT
>probe:Drosophila_2:1622937_at:615:161; Interrogation_Position=1270; Antisense; ACAATGGCGCTGGATGTGTCATCTC
>probe:Drosophila_2:1622937_at:315:569; Interrogation_Position=1297; Antisense; GGCAGTGCCACTACGTTCAATAATC
>probe:Drosophila_2:1622937_at:267:235; Interrogation_Position=1318; Antisense; AATCCTGGTTTCAAGGAGCCTCGCA
>probe:Drosophila_2:1622937_at:271:197; Interrogation_Position=1348; Antisense; AACGGCGTTTCGGTGACGGACGCAT
>probe:Drosophila_2:1622937_at:635:479; Interrogation_Position=1376; Antisense; GTAAGCCCTACAGCGGAATCCGGAA
>probe:Drosophila_2:1622937_at:100:511; Interrogation_Position=1444; Antisense; GTGACCAGCGTGTCCAATGGATCCA
>probe:Drosophila_2:1622937_at:94:651; Interrogation_Position=1489; Antisense; TCACCGCTGCGATCGAGTCTGAAGA
>probe:Drosophila_2:1622937_at:670:71; Interrogation_Position=1542; Antisense; AGGCATTCAAAATCCCGGCTATTCT
>probe:Drosophila_2:1622937_at:129:571; Interrogation_Position=1558; Antisense; GGCTATTCTGGATCCGGAAGCTCGC
>probe:Drosophila_2:1622937_at:467:363; Interrogation_Position=1619; Antisense; GAATTCAGACGCACAGCACCGAGGT

Paste this into a BLAST search page for me
GCAGGAGCGCTATGGCTTCAAGATAGGGCATTTCCTTCTATATACAGATTTTTGACAATTGCTCTGTTCGTGGCCGTACGATGTGATCTACTCGCGCAGTACAATGGCGCTGGATGTGTCATCTCGGCAGTGCCACTACGTTCAATAATCAATCCTGGTTTCAAGGAGCCTCGCAAACGGCGTTTCGGTGACGGACGCATGTAAGCCCTACAGCGGAATCCGGAAGTGACCAGCGTGTCCAATGGATCCATCACCGCTGCGATCGAGTCTGAAGAAGGCATTCAAAATCCCGGCTATTCTGGCTATTCTGGATCCGGAAGCTCGCGAATTCAGACGCACAGCACCGAGGT

Full Affymetrix probeset data:

Annotations for 1622937_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime