Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622939_at:

>probe:Drosophila_2:1622939_at:365:337; Interrogation_Position=3919; Antisense; GCTCCCCTATCCACATTATATAGTT
>probe:Drosophila_2:1622939_at:450:29; Interrogation_Position=3960; Antisense; ATACTACACGCAACCGATACGAAAG
>probe:Drosophila_2:1622939_at:571:179; Interrogation_Position=4081; Antisense; AAACACAAACACACCTCTCAGAGAA
>probe:Drosophila_2:1622939_at:84:305; Interrogation_Position=4094; Antisense; CCTCTCAGAGAAACCCACACAAAAA
>probe:Drosophila_2:1622939_at:230:403; Interrogation_Position=4181; Antisense; GACTTAAACAGATCAGATGCTGGCA
>probe:Drosophila_2:1622939_at:578:445; Interrogation_Position=4196; Antisense; GATGCTGGCAGGAGTAAACAAAATT
>probe:Drosophila_2:1622939_at:128:363; Interrogation_Position=4225; Antisense; GCAATCTTTTTGCATAAATCTAGCA
>probe:Drosophila_2:1622939_at:374:663; Interrogation_Position=4239; Antisense; TAAATCTAGCATTAACCCGACGTTG
>probe:Drosophila_2:1622939_at:194:103; Interrogation_Position=4246; Antisense; AGCATTAACCCGACGTTGAAGACGA
>probe:Drosophila_2:1622939_at:11:469; Interrogation_Position=4260; Antisense; GTTGAAGACGATGGACGCCGCAATA
>probe:Drosophila_2:1622939_at:537:585; Interrogation_Position=4271; Antisense; TGGACGCCGCAATAAGGAGACGATC
>probe:Drosophila_2:1622939_at:359:551; Interrogation_Position=4286; Antisense; GGAGACGATCAAGAAAGCACGGCAT
>probe:Drosophila_2:1622939_at:194:393; Interrogation_Position=4298; Antisense; GAAAGCACGGCATCATAACCAGAAT
>probe:Drosophila_2:1622939_at:586:127; Interrogation_Position=4315; Antisense; ACCAGAATAGAGTTCATGCAATGTG

Paste this into a BLAST search page for me
GCTCCCCTATCCACATTATATAGTTATACTACACGCAACCGATACGAAAGAAACACAAACACACCTCTCAGAGAACCTCTCAGAGAAACCCACACAAAAAGACTTAAACAGATCAGATGCTGGCAGATGCTGGCAGGAGTAAACAAAATTGCAATCTTTTTGCATAAATCTAGCATAAATCTAGCATTAACCCGACGTTGAGCATTAACCCGACGTTGAAGACGAGTTGAAGACGATGGACGCCGCAATATGGACGCCGCAATAAGGAGACGATCGGAGACGATCAAGAAAGCACGGCATGAAAGCACGGCATCATAACCAGAATACCAGAATAGAGTTCATGCAATGTG

Full Affymetrix probeset data:

Annotations for 1622939_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime