FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622940_at:

>probe:Drosophila_2:1622940_at:645:513; Interrogation_Position=1330; Antisense; GTGATACTTCTGATATGCCGACAAT
>probe:Drosophila_2:1622940_at:294:313; Interrogation_Position=1365; Antisense; GCCAGCGCCGAATTCGAGAGCGAAT
>probe:Drosophila_2:1622940_at:304:435; Interrogation_Position=1392; Antisense; GAGGGTTCCGAAATATTCACTGCTT
>probe:Drosophila_2:1622940_at:123:13; Interrogation_Position=1406; Antisense; ATTCACTGCTTCCAGTACTTCGGAA
>probe:Drosophila_2:1622940_at:312:391; Interrogation_Position=1470; Antisense; GAAACGCATTTCATTGACGTCGGCT
>probe:Drosophila_2:1622940_at:537:721; Interrogation_Position=1483; Antisense; TTGACGTCGGCTCGCTGACATTCGG
>probe:Drosophila_2:1622940_at:332:251; Interrogation_Position=1555; Antisense; CAAGGACCACGGTGCAATGCATCGT
>probe:Drosophila_2:1622940_at:471:457; Interrogation_Position=1580; Antisense; GATACCACGCTTTTGGCTTTTTGAG
>probe:Drosophila_2:1622940_at:30:727; Interrogation_Position=1600; Antisense; TTGAGCCCGCCCAAAATCCTGGTAA
>probe:Drosophila_2:1622940_at:421:47; Interrogation_Position=1615; Antisense; ATCCTGGTAACTTCTGGCAGCGTCA
>probe:Drosophila_2:1622940_at:626:495; Interrogation_Position=1636; Antisense; GTCAGCGTTTCTACATCGAGTGCAA
>probe:Drosophila_2:1622940_at:478:637; Interrogation_Position=1651; Antisense; TCGAGTGCAATATTCCAACCAGGGA
>probe:Drosophila_2:1622940_at:129:367; Interrogation_Position=1755; Antisense; GAATCATTGGCCAACTTTACAAAGC
>probe:Drosophila_2:1622940_at:67:471; Interrogation_Position=1836; Antisense; GTTCGTCTTCAATTTACTTGCCACT

Paste this into a BLAST search page for me
GTGATACTTCTGATATGCCGACAATGCCAGCGCCGAATTCGAGAGCGAATGAGGGTTCCGAAATATTCACTGCTTATTCACTGCTTCCAGTACTTCGGAAGAAACGCATTTCATTGACGTCGGCTTTGACGTCGGCTCGCTGACATTCGGCAAGGACCACGGTGCAATGCATCGTGATACCACGCTTTTGGCTTTTTGAGTTGAGCCCGCCCAAAATCCTGGTAAATCCTGGTAACTTCTGGCAGCGTCAGTCAGCGTTTCTACATCGAGTGCAATCGAGTGCAATATTCCAACCAGGGAGAATCATTGGCCAACTTTACAAAGCGTTCGTCTTCAATTTACTTGCCACT

Full Affymetrix probeset data:

Annotations for 1622940_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720