FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622941_at:

>probe:Drosophila_2:1622941_at:661:645; Interrogation_Position=437; Antisense; TCAGGACTCCTCTGGACATATCGAG
>probe:Drosophila_2:1622941_at:140:133; Interrogation_Position=486; Antisense; ACCCAGATGGGCTTTCGATTCTCGC
>probe:Drosophila_2:1622941_at:547:463; Interrogation_Position=502; Antisense; GATTCTCGCCCGAATTCATAAACTT
>probe:Drosophila_2:1622941_at:703:213; Interrogation_Position=559; Antisense; AAGAGGTGTCCGTGGATCAGTTCAT
>probe:Drosophila_2:1622941_at:600:35; Interrogation_Position=574; Antisense; ATCAGTTCATAGTGCTCTGCGTGCA
>probe:Drosophila_2:1622941_at:92:81; Interrogation_Position=598; Antisense; AGGTGCAGCGTTTCACGGAGGCCTT
>probe:Drosophila_2:1622941_at:666:643; Interrogation_Position=655; Antisense; TCACCATTGGGTTCGAGGACTTCCT
>probe:Drosophila_2:1622941_at:515:581; Interrogation_Position=685; Antisense; TGGCCATTGGCTGCTCGTATTGAAA
>probe:Drosophila_2:1622941_at:469:231; Interrogation_Position=711; Antisense; AATGATTCAATGCAACCGCTCCATG
>probe:Drosophila_2:1622941_at:275:63; Interrogation_Position=733; Antisense; ATGGGAATGCATCTCCACAGTCTTG
>probe:Drosophila_2:1622941_at:415:325; Interrogation_Position=807; Antisense; GCGACTGGTGCATTTTTCTTAAATT
>probe:Drosophila_2:1622941_at:502:497; Interrogation_Position=876; Antisense; GTCATATTGCAATCTCCTGGTATCA
>probe:Drosophila_2:1622941_at:211:685; Interrogation_Position=918; Antisense; TATTTGTTAACGCAGTTCGACTCAA
>probe:Drosophila_2:1622941_at:260:491; Interrogation_Position=951; Antisense; GTACAAAGTCTCTTGCGCCTAATAA

Paste this into a BLAST search page for me
TCAGGACTCCTCTGGACATATCGAGACCCAGATGGGCTTTCGATTCTCGCGATTCTCGCCCGAATTCATAAACTTAAGAGGTGTCCGTGGATCAGTTCATATCAGTTCATAGTGCTCTGCGTGCAAGGTGCAGCGTTTCACGGAGGCCTTTCACCATTGGGTTCGAGGACTTCCTTGGCCATTGGCTGCTCGTATTGAAAAATGATTCAATGCAACCGCTCCATGATGGGAATGCATCTCCACAGTCTTGGCGACTGGTGCATTTTTCTTAAATTGTCATATTGCAATCTCCTGGTATCATATTTGTTAACGCAGTTCGACTCAAGTACAAAGTCTCTTGCGCCTAATAA

Full Affymetrix probeset data:

Annotations for 1622941_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720