Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622943_s_at:

>probe:Drosophila_2:1622943_s_at:112:541; Interrogation_Position=1005; Antisense; GGATCTTCCAAACAGGACTAGTTTT
>probe:Drosophila_2:1622943_s_at:94:675; Interrogation_Position=1037; Antisense; TAGAACTTACCCTCTGCAAAATAAT
>probe:Drosophila_2:1622943_s_at:494:243; Interrogation_Position=501; Antisense; AATTTGGCCAGCAAGCGGTACGAAT
>probe:Drosophila_2:1622943_s_at:575:373; Interrogation_Position=537; Antisense; GAAGATGTGGCCTGGAAGCTCAACA
>probe:Drosophila_2:1622943_s_at:714:189; Interrogation_Position=558; Antisense; AACATGGAGATCTCCTCGCATTGCC
>probe:Drosophila_2:1622943_s_at:116:283; Interrogation_Position=572; Antisense; CTCGCATTGCCAGCAGCGGGAGAAG
>probe:Drosophila_2:1622943_s_at:83:509; Interrogation_Position=609; Antisense; GTGCTCCAAATGAAAACGGCCGTCG
>probe:Drosophila_2:1622943_s_at:300:635; Interrogation_Position=649; Antisense; TCGAAATGACACAACCGGAACTAAT
>probe:Drosophila_2:1622943_s_at:359:249; Interrogation_Position=683; Antisense; CAATCAGTTCGAGAGCATCCAGGGC
>probe:Drosophila_2:1622943_s_at:108:377; Interrogation_Position=731; Antisense; GAAGACTACAGGAGCAACGGCGCCT
>probe:Drosophila_2:1622943_s_at:288:359; Interrogation_Position=744; Antisense; GCAACGGCGCCTGGCAATCAGTAGT
>probe:Drosophila_2:1622943_s_at:214:645; Interrogation_Position=761; Antisense; TCAGTAGTGGGACGCCATCGACCAA
>probe:Drosophila_2:1622943_s_at:67:43; Interrogation_Position=777; Antisense; ATCGACCAATTCCAGTGCCAATTTT
>probe:Drosophila_2:1622943_s_at:436:523; Interrogation_Position=910; Antisense; GGGTTTTTCCTATGTTCTGGCTAAT

Paste this into a BLAST search page for me
GGATCTTCCAAACAGGACTAGTTTTTAGAACTTACCCTCTGCAAAATAATAATTTGGCCAGCAAGCGGTACGAATGAAGATGTGGCCTGGAAGCTCAACAAACATGGAGATCTCCTCGCATTGCCCTCGCATTGCCAGCAGCGGGAGAAGGTGCTCCAAATGAAAACGGCCGTCGTCGAAATGACACAACCGGAACTAATCAATCAGTTCGAGAGCATCCAGGGCGAAGACTACAGGAGCAACGGCGCCTGCAACGGCGCCTGGCAATCAGTAGTTCAGTAGTGGGACGCCATCGACCAAATCGACCAATTCCAGTGCCAATTTTGGGTTTTTCCTATGTTCTGGCTAAT

Full Affymetrix probeset data:

Annotations for 1622943_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime