FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622944_at:

>probe:Drosophila_2:1622944_at:10:251; Interrogation_Position=1002; Antisense; CAAGGAAGAAGCGACCCGTGGCTCC
>probe:Drosophila_2:1622944_at:199:727; Interrogation_Position=1038; Antisense; TTGAGGCACCCTCGGATACCGCAAA
>probe:Drosophila_2:1622944_at:720:365; Interrogation_Position=1088; Antisense; GAATCATCCGACGATGACTCTGATA
>probe:Drosophila_2:1622944_at:700:455; Interrogation_Position=1109; Antisense; GATAAAGAGCCATCTGCACGCAGAG
>probe:Drosophila_2:1622944_at:149:343; Interrogation_Position=1138; Antisense; GCTTCAAAAGCTGCCATCTGGTGGA
>probe:Drosophila_2:1622944_at:243:119; Interrogation_Position=1162; Antisense; AGCTGATATGGATGCCACCGCCGAA
>probe:Drosophila_2:1622944_at:708:161; Interrogation_Position=1214; Antisense; ACAATCGAGACTGGATCTGCAGCCC
>probe:Drosophila_2:1622944_at:147:699; Interrogation_Position=1284; Antisense; TTTAGGCGCCAGTCAAGCAAAATTC
>probe:Drosophila_2:1622944_at:327:259; Interrogation_Position=837; Antisense; CACGAAGTGCCATCGATCGCATTGT
>probe:Drosophila_2:1622944_at:449:5; Interrogation_Position=857; Antisense; ATTGTGGACTTCATCGTGGGTGACA
>probe:Drosophila_2:1622944_at:257:267; Interrogation_Position=880; Antisense; CAGTCCAAAGGATCGATTCGGCATG
>probe:Drosophila_2:1622944_at:683:9; Interrogation_Position=895; Antisense; ATTCGGCATGATCTGCAAGGCGTGC
>probe:Drosophila_2:1622944_at:409:83; Interrogation_Position=950; Antisense; GAGTACGAGTACACTACCTTCCGGT
>probe:Drosophila_2:1622944_at:44:627; Interrogation_Position=976; Antisense; TGCCTTCTGCAATGTACTTAACCCG

Paste this into a BLAST search page for me
CAAGGAAGAAGCGACCCGTGGCTCCTTGAGGCACCCTCGGATACCGCAAAGAATCATCCGACGATGACTCTGATAGATAAAGAGCCATCTGCACGCAGAGGCTTCAAAAGCTGCCATCTGGTGGAAGCTGATATGGATGCCACCGCCGAAACAATCGAGACTGGATCTGCAGCCCTTTAGGCGCCAGTCAAGCAAAATTCCACGAAGTGCCATCGATCGCATTGTATTGTGGACTTCATCGTGGGTGACACAGTCCAAAGGATCGATTCGGCATGATTCGGCATGATCTGCAAGGCGTGCGAGTACGAGTACACTACCTTCCGGTTGCCTTCTGCAATGTACTTAACCCG

Full Affymetrix probeset data:

Annotations for 1622944_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720