Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622948_at:

>probe:Drosophila_2:1622948_at:150:249; Interrogation_Position=102; Antisense; AATTGGCATAACGACCGCAGTTCGC
>probe:Drosophila_2:1622948_at:666:267; Interrogation_Position=149; Antisense; CAGGTGCACCTTTTGCCAGTATGAA
>probe:Drosophila_2:1622948_at:495:383; Interrogation_Position=171; Antisense; GAACTGAGTGATGACGACCGGCGCC
>probe:Drosophila_2:1622948_at:667:53; Interrogation_Position=216; Antisense; ATGCACAATCTCTGCTACTTGGTGT
>probe:Drosophila_2:1622948_at:462:667; Interrogation_Position=231; Antisense; TACTTGGTGTTTCGCTATTCCCATA
>probe:Drosophila_2:1622948_at:218:11; Interrogation_Position=247; Antisense; ATTCCCATAGAAAGTGCCTCGAGTG
>probe:Drosophila_2:1622948_at:601:685; Interrogation_Position=293; Antisense; TATAGCCGGTGACTTGTGCACGATT
>probe:Drosophila_2:1622948_at:601:509; Interrogation_Position=308; Antisense; GTGCACGATTTGTTTAGATCCCCTA
>probe:Drosophila_2:1622948_at:507:681; Interrogation_Position=321; Antisense; TTAGATCCCCTAAGTGTTTACACCA
>probe:Drosophila_2:1622948_at:113:157; Interrogation_Position=340; Antisense; ACACCATGGTGTATCTGCGCTGCAG
>probe:Drosophila_2:1622948_at:440:721; Interrogation_Position=372; Antisense; TTGCATGAGAAGTGCCTCCACCAGT
>probe:Drosophila_2:1622948_at:60:91; Interrogation_Position=394; Antisense; AGTACCAGGCTAATGGTGGCCGCCA
>probe:Drosophila_2:1622948_at:112:259; Interrogation_Position=417; Antisense; CACTGTCCGGTCTGCAGAATGGGAA
>probe:Drosophila_2:1622948_at:635:625; Interrogation_Position=83; Antisense; TGCCGCTTTCGCCTATTTCAATTGG

Paste this into a BLAST search page for me
AATTGGCATAACGACCGCAGTTCGCCAGGTGCACCTTTTGCCAGTATGAAGAACTGAGTGATGACGACCGGCGCCATGCACAATCTCTGCTACTTGGTGTTACTTGGTGTTTCGCTATTCCCATAATTCCCATAGAAAGTGCCTCGAGTGTATAGCCGGTGACTTGTGCACGATTGTGCACGATTTGTTTAGATCCCCTATTAGATCCCCTAAGTGTTTACACCAACACCATGGTGTATCTGCGCTGCAGTTGCATGAGAAGTGCCTCCACCAGTAGTACCAGGCTAATGGTGGCCGCCACACTGTCCGGTCTGCAGAATGGGAATGCCGCTTTCGCCTATTTCAATTGG

Full Affymetrix probeset data:

Annotations for 1622948_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime