Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622949_at:

>probe:Drosophila_2:1622949_at:168:337; Interrogation_Position=5981; Antisense; GCTCCAAGCTGGGACTAAAGCTCCA
>probe:Drosophila_2:1622949_at:539:663; Interrogation_Position=5996; Antisense; TAAAGCTCCACGACCTGCTGGACAA
>probe:Drosophila_2:1622949_at:604:413; Interrogation_Position=6007; Antisense; GACCTGCTGGACAAGGCGAGCGAAT
>probe:Drosophila_2:1622949_at:541:359; Interrogation_Position=6091; Antisense; GCAACGGTCGCTGGCTCGGATCTGA
>probe:Drosophila_2:1622949_at:336:287; Interrogation_Position=6101; Antisense; CTGGCTCGGATCTGATTGGCAATCT
>probe:Drosophila_2:1622949_at:53:583; Interrogation_Position=6117; Antisense; TGGCAATCTATTGGGCATCAGTGAT
>probe:Drosophila_2:1622949_at:22:347; Interrogation_Position=6131; Antisense; GCATCAGTGATCAGGGCATTCTCAA
>probe:Drosophila_2:1622949_at:658:137; Interrogation_Position=6176; Antisense; ACGAGGCGGCCAAACTTCTGGGTGT
>probe:Drosophila_2:1622949_at:623:85; Interrogation_Position=6209; Antisense; AGTGAACGCAACTCGAGTGACAATC
>probe:Drosophila_2:1622949_at:197:237; Interrogation_Position=6230; Antisense; AATCGAGCGACACCAAGAGCCATAA
>probe:Drosophila_2:1622949_at:542:429; Interrogation_Position=6261; Antisense; GAGTAGCAGCAGTTTTACACCGCCT
>probe:Drosophila_2:1622949_at:109:707; Interrogation_Position=6275; Antisense; TTACACCGCCTTACGTATACCAAAG
>probe:Drosophila_2:1622949_at:454:549; Interrogation_Position=6398; Antisense; GGAGTGCGCTAAACAGCTCGATTAT
>probe:Drosophila_2:1622949_at:665:693; Interrogation_Position=6425; Antisense; TTTAGGAGTCACAGGCTCAAGCTAT

Paste this into a BLAST search page for me
GCTCCAAGCTGGGACTAAAGCTCCATAAAGCTCCACGACCTGCTGGACAAGACCTGCTGGACAAGGCGAGCGAATGCAACGGTCGCTGGCTCGGATCTGACTGGCTCGGATCTGATTGGCAATCTTGGCAATCTATTGGGCATCAGTGATGCATCAGTGATCAGGGCATTCTCAAACGAGGCGGCCAAACTTCTGGGTGTAGTGAACGCAACTCGAGTGACAATCAATCGAGCGACACCAAGAGCCATAAGAGTAGCAGCAGTTTTACACCGCCTTTACACCGCCTTACGTATACCAAAGGGAGTGCGCTAAACAGCTCGATTATTTTAGGAGTCACAGGCTCAAGCTAT

Full Affymetrix probeset data:

Annotations for 1622949_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime