Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622951_at:

>probe:Drosophila_2:1622951_at:131:631; Interrogation_Position=105; Antisense; TCCTCGGTCATGTTCTGGATCTAGA
>probe:Drosophila_2:1622951_at:148:543; Interrogation_Position=121; Antisense; GGATCTAGAAACATTGGAACTGCGT
>probe:Drosophila_2:1622951_at:61:195; Interrogation_Position=138; Antisense; AACTGCGTTTGGATTAGGATGTGCC
>probe:Drosophila_2:1622951_at:129:269; Interrogation_Position=162; Antisense; CATGAACTTCATGCCACTGGTGTGG
>probe:Drosophila_2:1622951_at:512:259; Interrogation_Position=176; Antisense; CACTGGTGTGGTACTACAACGACAA
>probe:Drosophila_2:1622951_at:439:693; Interrogation_Position=18; Antisense; TTTCCTCATAATTCTCGCTTTTTTC
>probe:Drosophila_2:1622951_at:318:51; Interrogation_Position=210; Antisense; ATGCGAAACGATGCCGTATCTCGGA
>probe:Drosophila_2:1622951_at:360:33; Interrogation_Position=25; Antisense; ATAATTCTCGCTTTTTTCACTCTGA
>probe:Drosophila_2:1622951_at:644:11; Interrogation_Position=255; Antisense; ATTCTGCTCTCTTCAGGACTGTCGA
>probe:Drosophila_2:1622951_at:334:75; Interrogation_Position=269; Antisense; AGGACTGTCGATTCACTTGTTTACA
>probe:Drosophila_2:1622951_at:465:711; Interrogation_Position=40; Antisense; TTCACTCTGAATATGGCCTTTGCCA
>probe:Drosophila_2:1622951_at:543:721; Interrogation_Position=59; Antisense; TTGCCAACTCGCAATTGCGATGCCG
>probe:Drosophila_2:1622951_at:552:447; Interrogation_Position=77; Antisense; GATGCCGCGCTCGAATGAATTCAGG
>probe:Drosophila_2:1622951_at:508:363; Interrogation_Position=93; Antisense; GAATTCAGGAGGTCCTCGGTCATGT

Paste this into a BLAST search page for me
TCCTCGGTCATGTTCTGGATCTAGAGGATCTAGAAACATTGGAACTGCGTAACTGCGTTTGGATTAGGATGTGCCCATGAACTTCATGCCACTGGTGTGGCACTGGTGTGGTACTACAACGACAATTTCCTCATAATTCTCGCTTTTTTCATGCGAAACGATGCCGTATCTCGGAATAATTCTCGCTTTTTTCACTCTGAATTCTGCTCTCTTCAGGACTGTCGAAGGACTGTCGATTCACTTGTTTACATTCACTCTGAATATGGCCTTTGCCATTGCCAACTCGCAATTGCGATGCCGGATGCCGCGCTCGAATGAATTCAGGGAATTCAGGAGGTCCTCGGTCATGT

Full Affymetrix probeset data:

Annotations for 1622951_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime