FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622952_at:

>probe:Drosophila_2:1622952_at:691:381; Interrogation_Position=183; Antisense; GAACGCGGAATCTTGGATCTGCAAT
>probe:Drosophila_2:1622952_at:88:617; Interrogation_Position=202; Antisense; TGCAATCCCATGAGCTGGCACTCAA
>probe:Drosophila_2:1622952_at:604:583; Interrogation_Position=217; Antisense; TGGCACTCAAGCAAAAGCGCGTCGA
>probe:Drosophila_2:1622952_at:7:285; Interrogation_Position=266; Antisense; CTGCATCCGTGGCATGGAGTTCGAT
>probe:Drosophila_2:1622952_at:585:549; Interrogation_Position=320; Antisense; GGAGAGAAAATCTGATCGACGCCCC
>probe:Drosophila_2:1622952_at:103:633; Interrogation_Position=415; Antisense; TCCCAAGGGCATACGAGTGCAGCGT
>probe:Drosophila_2:1622952_at:414:179; Interrogation_Position=443; Antisense; AAAACAAGCTATTGCCGGAGGTCGG
>probe:Drosophila_2:1622952_at:715:289; Interrogation_Position=458; Antisense; CGGAGGTCGGCATTCAGATTCACTT
>probe:Drosophila_2:1622952_at:97:463; Interrogation_Position=474; Antisense; GATTCACTTGAGATTGCCAACCATG
>probe:Drosophila_2:1622952_at:215:377; Interrogation_Position=498; Antisense; GAAGCTGATCGCATTGTGCTGCCTG
>probe:Drosophila_2:1622952_at:420:41; Interrogation_Position=606; Antisense; ATCTGGAGCTGGGTCCGGAAATCCG
>probe:Drosophila_2:1622952_at:609:559; Interrogation_Position=622; Antisense; GGAAATCCGTTCAGGTCTCCAAGCT
>probe:Drosophila_2:1622952_at:75:279; Interrogation_Position=663; Antisense; GTACTACGACGCTCCGATTGGGAAA
>probe:Drosophila_2:1622952_at:113:41; Interrogation_Position=690; Antisense; ATCGAAGACTATGTACGCCTGACGT

Paste this into a BLAST search page for me
GAACGCGGAATCTTGGATCTGCAATTGCAATCCCATGAGCTGGCACTCAATGGCACTCAAGCAAAAGCGCGTCGACTGCATCCGTGGCATGGAGTTCGATGGAGAGAAAATCTGATCGACGCCCCTCCCAAGGGCATACGAGTGCAGCGTAAAACAAGCTATTGCCGGAGGTCGGCGGAGGTCGGCATTCAGATTCACTTGATTCACTTGAGATTGCCAACCATGGAAGCTGATCGCATTGTGCTGCCTGATCTGGAGCTGGGTCCGGAAATCCGGGAAATCCGTTCAGGTCTCCAAGCTGTACTACGACGCTCCGATTGGGAAAATCGAAGACTATGTACGCCTGACGT

Full Affymetrix probeset data:

Annotations for 1622952_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720