Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622957_s_at:

>probe:Drosophila_2:1622957_s_at:424:143; Interrogation_Position=1495; Antisense; ACTCACCCCGAATGTCTATAATCAG
>probe:Drosophila_2:1622957_s_at:506:239; Interrogation_Position=1514; Antisense; AATCAGCCGCTAATTGTTCCTAGAC
>probe:Drosophila_2:1622957_s_at:587:413; Interrogation_Position=1536; Antisense; GACCAATAGTCGTGTATGAGCCCAT
>probe:Drosophila_2:1622957_s_at:289:125; Interrogation_Position=1554; Antisense; AGCCCATAGCCTGGAGTGCCTTGAA
>probe:Drosophila_2:1622957_s_at:617:635; Interrogation_Position=1574; Antisense; TTGAAGGCCGATCTCCAGTTATGGA
>probe:Drosophila_2:1622957_s_at:590:91; Interrogation_Position=1590; Antisense; AGTTATGGACTACCTTATCCTCACC
>probe:Drosophila_2:1622957_s_at:134:661; Interrogation_Position=1620; Antisense; TAACCTCACTCAGCGGACGATTAAC
>probe:Drosophila_2:1622957_s_at:116:25; Interrogation_Position=1708; Antisense; ATAGCAGAATCCTTGTGAATGTCAC
>probe:Drosophila_2:1622957_s_at:688:369; Interrogation_Position=1724; Antisense; GAATGTCACACGAATACCAATGCAG
>probe:Drosophila_2:1622957_s_at:683:383; Interrogation_Position=1813; Antisense; GGAATAAACCTTCACCCTAGGTGCA
>probe:Drosophila_2:1622957_s_at:237:333; Interrogation_Position=1835; Antisense; GCACAGAAAGGGTTTTTGCCTGTTT
>probe:Drosophila_2:1622957_s_at:100:335; Interrogation_Position=1876; Antisense; GCTGCATCATTGAACAAGCACCATT
>probe:Drosophila_2:1622957_s_at:663:271; Interrogation_Position=1897; Antisense; CATTTGCTGCACCATACGAAAGGTT
>probe:Drosophila_2:1622957_s_at:507:17; Interrogation_Position=1944; Antisense; ATTTACATTTACGTTGTGCCCGCAA

Paste this into a BLAST search page for me
ACTCACCCCGAATGTCTATAATCAGAATCAGCCGCTAATTGTTCCTAGACGACCAATAGTCGTGTATGAGCCCATAGCCCATAGCCTGGAGTGCCTTGAATTGAAGGCCGATCTCCAGTTATGGAAGTTATGGACTACCTTATCCTCACCTAACCTCACTCAGCGGACGATTAACATAGCAGAATCCTTGTGAATGTCACGAATGTCACACGAATACCAATGCAGGGAATAAACCTTCACCCTAGGTGCAGCACAGAAAGGGTTTTTGCCTGTTTGCTGCATCATTGAACAAGCACCATTCATTTGCTGCACCATACGAAAGGTTATTTACATTTACGTTGTGCCCGCAA

Full Affymetrix probeset data:

Annotations for 1622957_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime