Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622960_at:

>probe:Drosophila_2:1622960_at:610:285; Interrogation_Position=1191; Antisense; CTGTCGCGGAGCCAACCTGGAAAAG
>probe:Drosophila_2:1622960_at:604:309; Interrogation_Position=1229; Antisense; CCAGCTTCGCTGTGATGACCAGGGA
>probe:Drosophila_2:1622960_at:700:495; Interrogation_Position=1324; Antisense; GTCTTCTACTCCACATTCGACAAAT
>probe:Drosophila_2:1622960_at:437:397; Interrogation_Position=1342; Antisense; GACAAATTCTTCTCATTCCGTAACG
>probe:Drosophila_2:1622960_at:563:659; Interrogation_Position=1362; Antisense; TAACGTTGACGATGGCTCCTGGTTC
>probe:Drosophila_2:1622960_at:368:223; Interrogation_Position=1486; Antisense; AAGGTGGCCTACGAGTACCAGTCGA
>probe:Drosophila_2:1622960_at:111:363; Interrogation_Position=1509; Antisense; GAATACGAAGAACGAGGCCCTCAAC
>probe:Drosophila_2:1622960_at:112:233; Interrogation_Position=1545; Antisense; AATGCCCAACTTTATGTCGACACTG
>probe:Drosophila_2:1622960_at:664:609; Interrogation_Position=1568; Antisense; TGACCAAAACATTCCAGCTGCGTGT
>probe:Drosophila_2:1622960_at:154:119; Interrogation_Position=1583; Antisense; AGCTGCGTGTTAAGCCCAAGACCTG
>probe:Drosophila_2:1622960_at:96:609; Interrogation_Position=1606; Antisense; TGAGCTCCGGTCACGAAATCAGCGA
>probe:Drosophila_2:1622960_at:35:651; Interrogation_Position=1624; Antisense; TCAGCGACAATCCAATCGGGACTGT
>probe:Drosophila_2:1622960_at:410:141; Interrogation_Position=1644; Antisense; ACTGTGAGTCAGTCCGCGGGTCAAG
>probe:Drosophila_2:1622960_at:444:553; Interrogation_Position=1675; Antisense; GGACGCCACAACTCTTTCATTTAAT

Paste this into a BLAST search page for me
CTGTCGCGGAGCCAACCTGGAAAAGCCAGCTTCGCTGTGATGACCAGGGAGTCTTCTACTCCACATTCGACAAATGACAAATTCTTCTCATTCCGTAACGTAACGTTGACGATGGCTCCTGGTTCAAGGTGGCCTACGAGTACCAGTCGAGAATACGAAGAACGAGGCCCTCAACAATGCCCAACTTTATGTCGACACTGTGACCAAAACATTCCAGCTGCGTGTAGCTGCGTGTTAAGCCCAAGACCTGTGAGCTCCGGTCACGAAATCAGCGATCAGCGACAATCCAATCGGGACTGTACTGTGAGTCAGTCCGCGGGTCAAGGGACGCCACAACTCTTTCATTTAAT

Full Affymetrix probeset data:

Annotations for 1622960_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime