FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622964_at:

>probe:Drosophila_2:1622964_at:14:467; Interrogation_Position=1006; Antisense; GATTGGCCCAAGTTGATTGCTTACT
>probe:Drosophila_2:1622964_at:314:31; Interrogation_Position=1073; Antisense; ATAAGCTAATCAATCGTACACCCCA
>probe:Drosophila_2:1622964_at:441:489; Interrogation_Position=1088; Antisense; GTACACCCCACGCAAATGATATGGA
>probe:Drosophila_2:1622964_at:202:497; Interrogation_Position=1161; Antisense; GTCATCGGATATGGCCCAGGGTCTT
>probe:Drosophila_2:1622964_at:255:531; Interrogation_Position=1179; Antisense; GGGTCTTGTGGCAGGTCAACAGCTA
>probe:Drosophila_2:1622964_at:285:711; Interrogation_Position=622; Antisense; TTCAAATGCGGCACTGGCGTTGCGC
>probe:Drosophila_2:1622964_at:165:699; Interrogation_Position=685; Antisense; TTTTCTGCGATGCTTGCACTTCCAA
>probe:Drosophila_2:1622964_at:175:311; Interrogation_Position=706; Antisense; CCAACTGGCTTGGTTTGCATGTGTG
>probe:Drosophila_2:1622964_at:352:347; Interrogation_Position=722; Antisense; GCATGTGTGAGCTTCTCGTTTGCAA
>probe:Drosophila_2:1622964_at:304:163; Interrogation_Position=792; Antisense; AAATTCCATTCGAGCCCTGTCTGAA
>probe:Drosophila_2:1622964_at:39:303; Interrogation_Position=806; Antisense; CCCTGTCTGAACTTCGCGAGATTGA
>probe:Drosophila_2:1622964_at:150:187; Interrogation_Position=853; Antisense; AACAACTATGTTAGCTTTCTGCAAC
>probe:Drosophila_2:1622964_at:406:243; Interrogation_Position=953; Antisense; AATATGTGTCCAATCCCCTAAATTC
>probe:Drosophila_2:1622964_at:473:689; Interrogation_Position=979; Antisense; TTTGGACTTTTAAGGCGGGCTCATC

Paste this into a BLAST search page for me
GATTGGCCCAAGTTGATTGCTTACTATAAGCTAATCAATCGTACACCCCAGTACACCCCACGCAAATGATATGGAGTCATCGGATATGGCCCAGGGTCTTGGGTCTTGTGGCAGGTCAACAGCTATTCAAATGCGGCACTGGCGTTGCGCTTTTCTGCGATGCTTGCACTTCCAACCAACTGGCTTGGTTTGCATGTGTGGCATGTGTGAGCTTCTCGTTTGCAAAAATTCCATTCGAGCCCTGTCTGAACCCTGTCTGAACTTCGCGAGATTGAAACAACTATGTTAGCTTTCTGCAACAATATGTGTCCAATCCCCTAAATTCTTTGGACTTTTAAGGCGGGCTCATC

Full Affymetrix probeset data:

Annotations for 1622964_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720