Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622968_at:

>probe:Drosophila_2:1622968_at:129:227; Interrogation_Position=2197; Antisense; AAGGCGCAGCTCTTGGACCAGAACA
>probe:Drosophila_2:1622968_at:240:709; Interrogation_Position=2228; Antisense; TTAAGGCACAGCTGGGAGCCTCGAC
>probe:Drosophila_2:1622968_at:518:437; Interrogation_Position=2302; Antisense; GAGGAGCTAAATGCCGCTCGCTACC
>probe:Drosophila_2:1622968_at:62:269; Interrogation_Position=2326; Antisense; CAGGCCAACATGTACTTTGCCGAAA
>probe:Drosophila_2:1622968_at:349:277; Interrogation_Position=2363; Antisense; CTAAGGAGCTGGAGACACTACGTCA
>probe:Drosophila_2:1622968_at:406:147; Interrogation_Position=2379; Antisense; ACTACGTCAGCAGTTATCAGCCGAA
>probe:Drosophila_2:1622968_at:291:361; Interrogation_Position=2424; Antisense; GCAAGATTCCCTGGCGGCGATGCAA
>probe:Drosophila_2:1622968_at:672:107; Interrogation_Position=2511; Antisense; AGAAGCGGGCTCGACTAATACCCTT
>probe:Drosophila_2:1622968_at:466:609; Interrogation_Position=2526; Antisense; TAATACCCTTCCGACTTCCAATGTA
>probe:Drosophila_2:1622968_at:367:231; Interrogation_Position=2545; Antisense; AATGTAGCTCCAAGCGTGCCGGCAG
>probe:Drosophila_2:1622968_at:539:541; Interrogation_Position=2596; Antisense; GGCACCGCCAGCAGGTAGAAATCGT
>probe:Drosophila_2:1622968_at:231:493; Interrogation_Position=2619; Antisense; GTAACGCGGATGAGTTGCTAGCCAC
>probe:Drosophila_2:1622968_at:395:427; Interrogation_Position=2630; Antisense; GAGTTGCTAGCCACGTACATGTTAC
>probe:Drosophila_2:1622968_at:48:587; Interrogation_Position=2658; Antisense; TGGAAATTGCTCGACTGCCCTAAAA

Paste this into a BLAST search page for me
AAGGCGCAGCTCTTGGACCAGAACATTAAGGCACAGCTGGGAGCCTCGACGAGGAGCTAAATGCCGCTCGCTACCCAGGCCAACATGTACTTTGCCGAAACTAAGGAGCTGGAGACACTACGTCAACTACGTCAGCAGTTATCAGCCGAAGCAAGATTCCCTGGCGGCGATGCAAAGAAGCGGGCTCGACTAATACCCTTTAATACCCTTCCGACTTCCAATGTAAATGTAGCTCCAAGCGTGCCGGCAGGGCACCGCCAGCAGGTAGAAATCGTGTAACGCGGATGAGTTGCTAGCCACGAGTTGCTAGCCACGTACATGTTACTGGAAATTGCTCGACTGCCCTAAAA

Full Affymetrix probeset data:

Annotations for 1622968_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime