FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622969_at:

>probe:Drosophila_2:1622969_at:475:605; Interrogation_Position=2073; Antisense; TGATAATCTCGTGAGCATCCTGTCC
>probe:Drosophila_2:1622969_at:193:193; Interrogation_Position=2124; Antisense; AACTCGCGAGAGTCAAGCTGTCATG
>probe:Drosophila_2:1622969_at:534:93; Interrogation_Position=2168; Antisense; AGATTCGGGAGTCTTTCTACGCCAA
>probe:Drosophila_2:1622969_at:295:361; Interrogation_Position=2194; Antisense; GCAAGACCATCTGTGCAGGCACGGA
>probe:Drosophila_2:1622969_at:356:433; Interrogation_Position=2236; Antisense; GAGGTTGCCATTCGCGAAGACTTTC
>probe:Drosophila_2:1622969_at:638:391; Interrogation_Position=2271; Antisense; GAAACCACGCGATTTTGTGACGGAA
>probe:Drosophila_2:1622969_at:6:401; Interrogation_Position=2306; Antisense; GACTCCGTAATATGCAACCGACTAA
>probe:Drosophila_2:1622969_at:52:155; Interrogation_Position=2364; Antisense; AAGAAAGTACCCCTCATTGATTAGA
>probe:Drosophila_2:1622969_at:650:689; Interrogation_Position=2390; Antisense; TATTGGCACCACACGAAGAACTTGT
>probe:Drosophila_2:1622969_at:128:147; Interrogation_Position=2409; Antisense; ACTTGTACCCAAGATTTCCGCGGAT
>probe:Drosophila_2:1622969_at:688:229; Interrogation_Position=2448; Antisense; AATGCATCCGCGGAAACCCGTTAGA
>probe:Drosophila_2:1622969_at:707:375; Interrogation_Position=2532; Antisense; GAAGAAATCGCCTCCAGATGCTAAA
>probe:Drosophila_2:1622969_at:550:427; Interrogation_Position=2548; Antisense; GATGCTAAAGTCTGTCGTCTAAGTG
>probe:Drosophila_2:1622969_at:419:89; Interrogation_Position=2625; Antisense; AGTCAATCTTGTATCTCTATCCTAA

Paste this into a BLAST search page for me
TGATAATCTCGTGAGCATCCTGTCCAACTCGCGAGAGTCAAGCTGTCATGAGATTCGGGAGTCTTTCTACGCCAAGCAAGACCATCTGTGCAGGCACGGAGAGGTTGCCATTCGCGAAGACTTTCGAAACCACGCGATTTTGTGACGGAAGACTCCGTAATATGCAACCGACTAAAAGAAAGTACCCCTCATTGATTAGATATTGGCACCACACGAAGAACTTGTACTTGTACCCAAGATTTCCGCGGATAATGCATCCGCGGAAACCCGTTAGAGAAGAAATCGCCTCCAGATGCTAAAGATGCTAAAGTCTGTCGTCTAAGTGAGTCAATCTTGTATCTCTATCCTAA

Full Affymetrix probeset data:

Annotations for 1622969_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720