Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622970_at:

>probe:Drosophila_2:1622970_at:251:237; Interrogation_Position=4658; Antisense; AATCGAGTATCCATGGTAGCACCAG
>probe:Drosophila_2:1622970_at:272:535; Interrogation_Position=4749; Antisense; GGTGCTGGTGAAAAATGCCCTGAAC
>probe:Drosophila_2:1622970_at:113:577; Interrogation_Position=4785; Antisense; GGCCAGGATGAGTGCGAACCCCAGT
>probe:Drosophila_2:1622970_at:237:99; Interrogation_Position=4817; Antisense; AGAGGAGCACTAGCAGCAGTCGATC
>probe:Drosophila_2:1622970_at:680:349; Interrogation_Position=4832; Antisense; GCAGTCGATCCGTGAGCAGCTTCAT
>probe:Drosophila_2:1622970_at:683:349; Interrogation_Position=4871; Antisense; GCAGTGCCACCAAGCGACAGAAGTG
>probe:Drosophila_2:1622970_at:628:607; Interrogation_Position=4894; Antisense; TGAGGGCCGGCAGTCCAGTCCAGTT
>probe:Drosophila_2:1622970_at:193:629; Interrogation_Position=4912; Antisense; TCCAGTTCAGTCATCGTCCAAGTTA
>probe:Drosophila_2:1622970_at:56:465; Interrogation_Position=4933; Antisense; GTTAACGTCCCAAGTTTACACATGT
>probe:Drosophila_2:1622970_at:648:663; Interrogation_Position=4958; Antisense; TACAAACGCGAATGCATCCAACTCC
>probe:Drosophila_2:1622970_at:255:125; Interrogation_Position=4984; Antisense; AGCCGTCCAAGCGACAATTTCGAAT
>probe:Drosophila_2:1622970_at:90:709; Interrogation_Position=5087; Antisense; TTAAGAATTCCCTGCACATTCCAAC
>probe:Drosophila_2:1622970_at:386:149; Interrogation_Position=5102; Antisense; ACATTCCAACTCAAGGTCCGCAAAT
>probe:Drosophila_2:1622970_at:315:397; Interrogation_Position=5140; Antisense; GACAACAACTTTCCAACTCTTAAAT

Paste this into a BLAST search page for me
AATCGAGTATCCATGGTAGCACCAGGGTGCTGGTGAAAAATGCCCTGAACGGCCAGGATGAGTGCGAACCCCAGTAGAGGAGCACTAGCAGCAGTCGATCGCAGTCGATCCGTGAGCAGCTTCATGCAGTGCCACCAAGCGACAGAAGTGTGAGGGCCGGCAGTCCAGTCCAGTTTCCAGTTCAGTCATCGTCCAAGTTAGTTAACGTCCCAAGTTTACACATGTTACAAACGCGAATGCATCCAACTCCAGCCGTCCAAGCGACAATTTCGAATTTAAGAATTCCCTGCACATTCCAACACATTCCAACTCAAGGTCCGCAAATGACAACAACTTTCCAACTCTTAAAT

Full Affymetrix probeset data:

Annotations for 1622970_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime