FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622971_at:

>probe:Drosophila_2:1622971_at:319:657; Interrogation_Position=1852; Antisense; TAATGCAACGTCAGGATTCCGCACC
>probe:Drosophila_2:1622971_at:19:157; Interrogation_Position=1877; Antisense; ACAGCGAGCAGTGACTCTAGCCGAA
>probe:Drosophila_2:1622971_at:573:17; Interrogation_Position=1908; Antisense; ATTTCAGTAACTTTGCTTCCACCTC
>probe:Drosophila_2:1622971_at:720:279; Interrogation_Position=1930; Antisense; CTCAAAGCCACAGTATCGTTCCAAT
>probe:Drosophila_2:1622971_at:308:245; Interrogation_Position=1952; Antisense; AATTGGTCAAACTACACGCCTTCGC
>probe:Drosophila_2:1622971_at:130:565; Interrogation_Position=1981; Antisense; GGAATCCAGCTATGTGTCCAACATA
>probe:Drosophila_2:1622971_at:59:191; Interrogation_Position=2000; Antisense; AACATACATCGCTTGTTTTCGGAGC
>probe:Drosophila_2:1622971_at:561:701; Interrogation_Position=2041; Antisense; TTCAGTAGAGTTCACCAAGGCCTCA
>probe:Drosophila_2:1622971_at:76:247; Interrogation_Position=2136; Antisense; AATTCGGACTTCAGCAGATTCAGGT
>probe:Drosophila_2:1622971_at:193:649; Interrogation_Position=2155; Antisense; TCAGGTGGATGCTCATTATCTGCAA
>probe:Drosophila_2:1622971_at:25:429; Interrogation_Position=2234; Antisense; GAGATTCTTGGCTCAGCTGTGCAAA
>probe:Drosophila_2:1622971_at:276:509; Interrogation_Position=2252; Antisense; GTGCAAAGGTGCTTGGAGTCCGTTT
>probe:Drosophila_2:1622971_at:445:429; Interrogation_Position=2267; Antisense; GAGTCCGTTTTAATGGAGCCCAATG
>probe:Drosophila_2:1622971_at:481:149; Interrogation_Position=2345; Antisense; ACATTCCACTTAAAATCTCCGTCTA

Paste this into a BLAST search page for me
TAATGCAACGTCAGGATTCCGCACCACAGCGAGCAGTGACTCTAGCCGAAATTTCAGTAACTTTGCTTCCACCTCCTCAAAGCCACAGTATCGTTCCAATAATTGGTCAAACTACACGCCTTCGCGGAATCCAGCTATGTGTCCAACATAAACATACATCGCTTGTTTTCGGAGCTTCAGTAGAGTTCACCAAGGCCTCAAATTCGGACTTCAGCAGATTCAGGTTCAGGTGGATGCTCATTATCTGCAAGAGATTCTTGGCTCAGCTGTGCAAAGTGCAAAGGTGCTTGGAGTCCGTTTGAGTCCGTTTTAATGGAGCCCAATGACATTCCACTTAAAATCTCCGTCTA

Full Affymetrix probeset data:

Annotations for 1622971_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720