FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622973_at:

>probe:Drosophila_2:1622973_at:210:241; Interrogation_Position=1070; Antisense; CAATAAATCCAAAATCCCCAACCAG
>probe:Drosophila_2:1622973_at:513:199; Interrogation_Position=1089; Antisense; AACCAGTTTCAATTTAGTCGGCATT
>probe:Drosophila_2:1622973_at:339:117; Interrogation_Position=685; Antisense; AGCTCCTGCGGAGCGATTCACAAGT
>probe:Drosophila_2:1622973_at:169:463; Interrogation_Position=699; Antisense; GATTCACAAGTCCATCGAGAAGCTG
>probe:Drosophila_2:1622973_at:596:397; Interrogation_Position=724; Antisense; GACAAGCAGGGCATGGACATCATTG
>probe:Drosophila_2:1622973_at:726:629; Interrogation_Position=766; Antisense; TCCTTCACCGAGTACTTGCGCAAGT
>probe:Drosophila_2:1622973_at:492:185; Interrogation_Position=793; Antisense; AACAATACGATATGCGGACGCCATC
>probe:Drosophila_2:1622973_at:208:135; Interrogation_Position=810; Antisense; ACGCCATCCCATCGGAGTAATGCTA
>probe:Drosophila_2:1622973_at:561:617; Interrogation_Position=830; Antisense; TGCTAGGCGCCGTGAAGGCACTGCA
>probe:Drosophila_2:1622973_at:210:217; Interrogation_Position=883; Antisense; AAGTTCCTCAAGTACGCCCAGAGCA
>probe:Drosophila_2:1622973_at:516:309; Interrogation_Position=900; Antisense; CCAGAGCAGCCAGTGTCAGGACATT
>probe:Drosophila_2:1622973_at:606:5; Interrogation_Position=922; Antisense; ATTGAGGACTCCAGCGTTAGCTACG
>probe:Drosophila_2:1622973_at:629:545; Interrogation_Position=952; Antisense; GGATCGCTCGTCTTCGAGATGTGAA
>probe:Drosophila_2:1622973_at:468:15; Interrogation_Position=988; Antisense; ATTTTAGCCACTCGACGGCAACTAA

Paste this into a BLAST search page for me
CAATAAATCCAAAATCCCCAACCAGAACCAGTTTCAATTTAGTCGGCATTAGCTCCTGCGGAGCGATTCACAAGTGATTCACAAGTCCATCGAGAAGCTGGACAAGCAGGGCATGGACATCATTGTCCTTCACCGAGTACTTGCGCAAGTAACAATACGATATGCGGACGCCATCACGCCATCCCATCGGAGTAATGCTATGCTAGGCGCCGTGAAGGCACTGCAAAGTTCCTCAAGTACGCCCAGAGCACCAGAGCAGCCAGTGTCAGGACATTATTGAGGACTCCAGCGTTAGCTACGGGATCGCTCGTCTTCGAGATGTGAAATTTTAGCCACTCGACGGCAACTAA

Full Affymetrix probeset data:

Annotations for 1622973_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720