FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622974_at:

>probe:Drosophila_2:1622974_at:708:153; Interrogation_Position=472; Antisense; ACAGGCTGGAGCACTTCTAGGCGGA
>probe:Drosophila_2:1622974_at:719:561; Interrogation_Position=572; Antisense; GGAACGGCCACATCCGGCCAGAGCG
>probe:Drosophila_2:1622974_at:326:123; Interrogation_Position=616; Antisense; AGCGCCGAGTCCAGCGGGTCCTCAG
>probe:Drosophila_2:1622974_at:458:535; Interrogation_Position=632; Antisense; GGTCCTCAGCCCGATGGCGAAGATG
>probe:Drosophila_2:1622974_at:162:577; Interrogation_Position=784; Antisense; GGCGCCGGCAGCGATTCCTGTTCAG
>probe:Drosophila_2:1622974_at:147:463; Interrogation_Position=796; Antisense; GATTCCTGTTCAGGCGGCTGTCCTG
>probe:Drosophila_2:1622974_at:288:303; Interrogation_Position=831; Antisense; CCGTTTGGGCTGATCCAGAGCCAAA
>probe:Drosophila_2:1622974_at:126:313; Interrogation_Position=850; Antisense; GCCAAATGCGATTCACGTTGTGTAA
>probe:Drosophila_2:1622974_at:727:649; Interrogation_Position=862; Antisense; TCACGTTGTGTAAACGCCCGGTGAC
>probe:Drosophila_2:1622974_at:688:607; Interrogation_Position=883; Antisense; TGACCTTTGTGCCATTTGCCTTAAC
>probe:Drosophila_2:1622974_at:27:303; Interrogation_Position=908; Antisense; CCCCTTTGATGGTCATTTAAGTTAG
>probe:Drosophila_2:1622974_at:666:467; Interrogation_Position=928; Antisense; GTTAGTCCTAAAGCTAGTCAATGTT
>probe:Drosophila_2:1622974_at:370:477; Interrogation_Position=950; Antisense; GTTTTTGGAGCTCACATTTACCCTA
>probe:Drosophila_2:1622974_at:715:1; Interrogation_Position=965; Antisense; ATTTACCCTAAGCTAAGGCAAGCGA

Paste this into a BLAST search page for me
ACAGGCTGGAGCACTTCTAGGCGGAGGAACGGCCACATCCGGCCAGAGCGAGCGCCGAGTCCAGCGGGTCCTCAGGGTCCTCAGCCCGATGGCGAAGATGGGCGCCGGCAGCGATTCCTGTTCAGGATTCCTGTTCAGGCGGCTGTCCTGCCGTTTGGGCTGATCCAGAGCCAAAGCCAAATGCGATTCACGTTGTGTAATCACGTTGTGTAAACGCCCGGTGACTGACCTTTGTGCCATTTGCCTTAACCCCCTTTGATGGTCATTTAAGTTAGGTTAGTCCTAAAGCTAGTCAATGTTGTTTTTGGAGCTCACATTTACCCTAATTTACCCTAAGCTAAGGCAAGCGA

Full Affymetrix probeset data:

Annotations for 1622974_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720