FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622975_at:

>probe:Drosophila_2:1622975_at:518:99; Interrogation_Position=103; Antisense; AGACCTTGAAAGCTACGAGCCCTAT
>probe:Drosophila_2:1622975_at:702:413; Interrogation_Position=119; Antisense; GAGCCCTATACAGAAGGTAGCCAAA
>probe:Drosophila_2:1622975_at:532:471; Interrogation_Position=13; Antisense; GTTCTAGTTCACAGCTCCTGAATAA
>probe:Drosophila_2:1622975_at:517:457; Interrogation_Position=179; Antisense; GATACCTCTGAGGACGCTCGCTTCT
>probe:Drosophila_2:1622975_at:307:341; Interrogation_Position=198; Antisense; GCTTCTCCGAGCAGGTATTCTCGAA
>probe:Drosophila_2:1622975_at:88:13; Interrogation_Position=214; Antisense; ATTCTCGAACATTCAGGAGCGTCTG
>probe:Drosophila_2:1622975_at:587:553; Interrogation_Position=229; Antisense; GGAGCGTCTGAACCGAATCATTAAT
>probe:Drosophila_2:1622975_at:278:237; Interrogation_Position=251; Antisense; AATCGCATTAGCATGGCCAACTCTG
>probe:Drosophila_2:1622975_at:594:193; Interrogation_Position=269; Antisense; AACTCTGCCGTGGTCCAGATGAAGA
>probe:Drosophila_2:1622975_at:560:71; Interrogation_Position=293; Antisense; AGGAAGCTCCATGCTCGAATTCCAT
>probe:Drosophila_2:1622975_at:239:9; Interrogation_Position=311; Antisense; ATTCCATCCGTACCTGTTGGCGAAA
>probe:Drosophila_2:1622975_at:63:297; Interrogation_Position=331; Antisense; CGAAAACGCCGACCAGTTGGCTGGA
>probe:Drosophila_2:1622975_at:484:547; Interrogation_Position=353; Antisense; GGAGGCGATAATCCAATGCGATTTG
>probe:Drosophila_2:1622975_at:640:499; Interrogation_Position=76; Antisense; GTCGGACGACGGATCTGATATATTC

Paste this into a BLAST search page for me
AGACCTTGAAAGCTACGAGCCCTATGAGCCCTATACAGAAGGTAGCCAAAGTTCTAGTTCACAGCTCCTGAATAAGATACCTCTGAGGACGCTCGCTTCTGCTTCTCCGAGCAGGTATTCTCGAAATTCTCGAACATTCAGGAGCGTCTGGGAGCGTCTGAACCGAATCATTAATAATCGCATTAGCATGGCCAACTCTGAACTCTGCCGTGGTCCAGATGAAGAAGGAAGCTCCATGCTCGAATTCCATATTCCATCCGTACCTGTTGGCGAAACGAAAACGCCGACCAGTTGGCTGGAGGAGGCGATAATCCAATGCGATTTGGTCGGACGACGGATCTGATATATTC

Full Affymetrix probeset data:

Annotations for 1622975_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720