Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1622976_at:

>probe:Drosophila_2:1622976_at:477:647; Interrogation_Position=1598; Antisense; TCATCACTCACATCTTGCCGAATGG
>probe:Drosophila_2:1622976_at:644:721; Interrogation_Position=1612; Antisense; TTGCCGAATGGCCAATCCCGCTACG
>probe:Drosophila_2:1622976_at:600:233; Interrogation_Position=1625; Antisense; AATCCCGCTACGCAGTCAGTGGCGT
>probe:Drosophila_2:1622976_at:314:497; Interrogation_Position=1639; Antisense; GTCAGTGGCGTGCATAATCATCCAT
>probe:Drosophila_2:1622976_at:412:575; Interrogation_Position=1645; Antisense; GGCGTGCATAATCATCCATAGATCA
>probe:Drosophila_2:1622976_at:107:271; Interrogation_Position=1657; Antisense; CATCCATAGATCAAAGAGCATTCAG
>probe:Drosophila_2:1622976_at:347:711; Interrogation_Position=1677; Antisense; TTCAGAAGTCTGAATCGGGACACAT
>probe:Drosophila_2:1622976_at:554:367; Interrogation_Position=1688; Antisense; GAATCGGGACACATACATAGCTGTA
>probe:Drosophila_2:1622976_at:96:461; Interrogation_Position=1715; Antisense; GATTAGGCAGCTTTTTGTACAGAAT
>probe:Drosophila_2:1622976_at:215:395; Interrogation_Position=1763; Antisense; GAAATCCATTTCTAGTTTTGCGCAA
>probe:Drosophila_2:1622976_at:78:477; Interrogation_Position=1777; Antisense; GTTTTGCGCAATAACACCTTTTAAT
>probe:Drosophila_2:1622976_at:526:187; Interrogation_Position=1789; Antisense; AACACCTTTTAATTTGTCAGATCTT
>probe:Drosophila_2:1622976_at:270:243; Interrogation_Position=1799; Antisense; AATTTGTCAGATCTTAAGCTTGATA
>probe:Drosophila_2:1622976_at:436:153; Interrogation_Position=1829; Antisense; ACAGGCTTAGGATTATTTTGCAGAA

Paste this into a BLAST search page for me
TCATCACTCACATCTTGCCGAATGGTTGCCGAATGGCCAATCCCGCTACGAATCCCGCTACGCAGTCAGTGGCGTGTCAGTGGCGTGCATAATCATCCATGGCGTGCATAATCATCCATAGATCACATCCATAGATCAAAGAGCATTCAGTTCAGAAGTCTGAATCGGGACACATGAATCGGGACACATACATAGCTGTAGATTAGGCAGCTTTTTGTACAGAATGAAATCCATTTCTAGTTTTGCGCAAGTTTTGCGCAATAACACCTTTTAATAACACCTTTTAATTTGTCAGATCTTAATTTGTCAGATCTTAAGCTTGATAACAGGCTTAGGATTATTTTGCAGAA

Full Affymetrix probeset data:

Annotations for 1622976_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime